WormBase Tree Display for Variation: WBVar00143668
expand all nodes | collapse all nodes | view schema
WBVar00143668 | Evidence | Paper_evidence | WBPaper00041593 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e995 | |||||
Other_name | e995xri | ||||||
Y41C4A.13.1:c.251G>A | |||||||
CE20253:p.Gly84Glu | |||||||
HGVSg | CHROMOSOME_III:g.11733726C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y41C4A | |||
Flanking_sequences | catgggtctgggtaaccctcgccttgttcg | agtcatcttcatcgcctccttcgtcatctc | |||||
Mapping_target | Y41C4A | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004371 | ||||||
WBStrain00004632 | |||||||
WBStrain00023498 | |||||||
WBStrain00023506 | |||||||
WBStrain00033410 | |||||||
WBStrain00033415 | |||||||
WBStrain00033416 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Linked_to | WBVar02145284 | ||||||
Affects (3) | |||||||
Genetics | Interpolated_map_position | III | 12.0399 | ||||
Mapping_data | In_2_point | 77 | |||||
89 | |||||||
In_multi_point | 92 | ||||||
1660 | |||||||
2028 | |||||||
2029 | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000886 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | dominant allele-specific suppressor of unc-17(e245); does not suppress unc-17(e876); no phenotype alone. Easy to score (ES3) in the presence of e245. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00041593 | ||||||
Method | Substitution_allele |