WormBase Tree Display for Variation: WBVar00143653
expand all nodes | collapse all nodes | view schema
WBVar00143653 | Name | Public_name | e979 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE46852:p.Cys146Tyr | ||||||||
Y55D5A.5c.1:c.437G>A | |||||||||
Y55D5A.5a.1:c.437G>A | |||||||||
CE50204:p.Cys146Tyr | |||||||||
Y55D5A.5d.1:c.296G>A | |||||||||
CE50312:p.Cys99Tyr | |||||||||
CE50158:p.Cys70Tyr | |||||||||
Y55D5A.5e.1:c.209G>A | |||||||||
HGVSg | CHROMOSOME_III:g.3017014C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y55D5A | |||||
Flanking_sequences | agccgtgtgcctcaatagtcgaaaaacgat | cggcccaatcgatattcgaaataggccgtg | |||||||
Mapping_target | Y55D5A | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00006391 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000898 | |||||||
Transcript | Y55D5A.5e.1 (12) | ||||||||
Y55D5A.5a.1 (12) | |||||||||
Y55D5A.5c.1 (12) | |||||||||
Y55D5A.5d.1 (12) | |||||||||
Interactor | WBInteraction000009107 | ||||||||
WBInteraction000009108 | |||||||||
WBInteraction000052470 | |||||||||
WBInteraction000517272 | |||||||||
WBInteraction000517275 | |||||||||
WBInteraction000517276 | |||||||||
WBInteraction000517281 | |||||||||
Genetics | Interpolated_map_position | III | -8.03771 | ||||||
Description | Phenotype | WBPhenotype:0000012 | Paper_evidence | WBPaper00000214 | |||||
WBPaper00031688 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The severe allele daf-2(e979) forms dauers even at 15 deg C. | Paper_evidence | WBPaper00031688 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 21.5 | Paper_evidence | WBPaper00031688 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000242 | Paper_evidence | WBPaper00059059 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | one daf-2(e979) embryo failed to elongate, beginning just before thetwo-fold stage (Fig. 1C). The failing embryo twitched normally at this stage, indicating that it had functional muscles, butwas unable to elongate past the two-fold length and retracted somewhat over a one hour period. After several hours, blebsappeared at the anterior end of the embryo and it eventually ruptured | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014948 | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007846 | PATO:0000460 | Paper_evidence | WBPaper00059059 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00059059 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000295 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | e979 has thermotolerance at least as high as e1370 | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00059059 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 98.9% of daf-2(e979) embryos reached early elongation midway through embryogenesis (comma stage), 10.6% of embryos arrested without hatching (Fig. 1A) | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014948 | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00059059 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00059059 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000964 | Paper_evidence | WBPaper00037649 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | strong resistance | Paper_evidence | WBPaper00037649 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001990 | Paper_evidence | WBPaper00035504 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | daf-2 allele e979 has moderate hypoxia resistance similar to that of m596. | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035504 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001536 | Paper_evidence | WBPaper00059059 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | All daf-2(e979) embryos examined showed hypodermal patterning that was similar to wild-type. | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014948 | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007846 | PATO:0000460 | Paper_evidence | WBPaper00059059 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00059059 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001566 | Paper_evidence | WBPaper00059059 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ventral views (not shown) revealed no difficulties with ventral enclosure and dorsal fusion of hypodermal cells appeared normal. | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014948 | Paper_evidence | WBPaper00059059 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007846 | PATO:0000460 | Paper_evidence | WBPaper00059059 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00059059 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031936 | ||||||||
WBPaper00000214 | |||||||||
WBPaper00037649 | |||||||||
WBPaper00031688 | |||||||||
WBPaper00035504 | |||||||||
WBPaper00059059 | |||||||||
Remark | Allele e979 is cited in WBPaper00005310. A subsequent erratum explains that the strain was incorrectly referred to as daf-2(e979) but was infact daf-2(m41). | Curator_confirmed | WBPerson2970 | ||||||
Method | Substitution_allele |