WormBase Tree Display for Variation: WBVar00143652
expand all nodes | collapse all nodes | view schema
WBVar00143652 | Evidence | Person_evidence | WBPerson10095 | ||
---|---|---|---|---|---|
Name | Public_name | e977 | |||
Other_name (2) | |||||
HGVSg | CHROMOSOME_IV:g.6377426G>A | ||||
Sequence_details | SMap | S_parent | Sequence | Y73B6BL | |
Flanking_sequences | tcaacgaggtctcctcgatccgttccaacc | taccgcccgtcaagcttcttacggagattc | |||
Mapping_target | Y73B6BL | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00051523 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00000256 | |||
Transcript | Y73B6BL.34.1 (12) | ||||
Genetics | Gene_class | bli | |||
Interpolated_map_position | IV | 3.18862 | |||
Remark | Variation information submitted by WBPerson10095 on 2022-02-17_15:55:28 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||
alt_det = g to a mut_det = R71H | Person_evidence | WBPerson10095 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Substitution_allele |