WormBase Tree Display for Variation: WBVar00143617
expand all nodes | collapse all nodes | view schema
WBVar00143617 | Name | Public_name | e937 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K04F10.4d.2:c.1971+275_1971+3600del | ||||||||
K04F10.4h.1:c.1971+275_*310del | |||||||||
K04F10.4i.1:c.1971+275_1972-438del | |||||||||
K04F10.4d.1:c.1971+275_1971+3600del | |||||||||
K04F10.4b.1:c.1971+275_1971+3600del | |||||||||
K04F10.4j.1:c.1971+275_1972-752del | |||||||||
K04F10.4c.1:c.1971+275_1971+3600del | |||||||||
HGVSg | CHROMOSOME_I:g.6345831_6349156del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K04F10 | |||||
Flanking_sequences | aaattgaaaaattgaaaaaatcaacaaaat | taatttccctgaatggaatttcaaccaaat | |||||||
Mapping_target | K04F10 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (502) | |||||||||
Laboratory | CB | ||||||||
CA | |||||||||
UP | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00200715 | |||||||
WBGene00000254 | |||||||||
Transcript (12) | |||||||||
Interactor | WBInteraction000537297 | ||||||||
Genetics | Interpolated_map_position | I | 1.02091 | ||||||
Mapping_data | In_2_point | 260 | |||||||
261 | |||||||||
262 | |||||||||
5220 | |||||||||
6170 | |||||||||
6188 | |||||||||
6193 | |||||||||
6200 | |||||||||
In_multi_point (15) | |||||||||
In_pos_neg_data | 509 | ||||||||
4020 | |||||||||
4026 | |||||||||
4035 | |||||||||
4040 | |||||||||
4047 | |||||||||
4054 | |||||||||
4061 | |||||||||
4065 | |||||||||
5317 | |||||||||
5360 | |||||||||
6196 | |||||||||
6313 | |||||||||
6357 | |||||||||
6373 | |||||||||
6403 | |||||||||
6432 | |||||||||
6450 | |||||||||
6465 | |||||||||
6471 | |||||||||
6478 | |||||||||
6485 | |||||||||
6490 | |||||||||
6497 | |||||||||
6505 | |||||||||
6521 | |||||||||
6527 | |||||||||
6536 | |||||||||
6550 | |||||||||
6562 | |||||||||
6594 | |||||||||
6601 | |||||||||
6606 | |||||||||
6612 | |||||||||
6624 | |||||||||
6642 | |||||||||
6658 | |||||||||
Marked_rearrangement | hT2[bli-4(e937) let-?(h661)] | ||||||||
hT2[bli-4(e937) let-?(q782) qIs48] | |||||||||
hT2[bli-4(e937) qIs48] | |||||||||
hT2[bli-4(e937) unc-29(h1011)] | |||||||||
hT2[bli-4(e937)] | |||||||||
Description | Phenotype | WBPhenotype:0000025 | Paper_evidence | WBPaper00001439 | |||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | adult blistered, especially head; penetrance 90%; unique Class I allele. Easy to score (ES3) in older adults. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
fully complemented by h754 and s90 | Paper_evidence | WBPaper00001439 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 90% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | animals arrest during hatching | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (30) | |||||||||
Remark | e937 is a 3325bp deletion | Paper_evidence | WBPaper00028453 | ||||||
Allele sequenced by Andrew Chisholm | |||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Deletion_allele |