WormBase Tree Display for Variation: WBVar00143616
expand all nodes | collapse all nodes | view schema
WBVar00143616 | Evidence | Paper_evidence | WBPaper00003027 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e936 | |||||||
Other_name | F55C7.7i.1:c.4191+1G>T | ||||||||
F55C7.7b.1:c.4191+1G>T | |||||||||
F55C7.7i.2:c.4191+1G>T | |||||||||
F55C7.7a.1:c.4191+1G>T | |||||||||
HGVSg | CHROMOSOME_I:g.4021953C>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55C7 | |||||
Flanking_sequences | ttacaactgtttggatttgaaggatttcaag | tagggcttggactttcaattaggtataatta | |||||||
Mapping_target | F55C7 | ||||||||
Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00003027 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000214 | ||||||||
WBStrain00004218 | |||||||||
WBStrain00004368 | |||||||||
WBStrain00023447 | |||||||||
WBStrain00055586 | |||||||||
WBStrain00055587 | |||||||||
WBStrain00055589 | |||||||||
WBStrain00055590 | |||||||||
WBStrain00055591 | |||||||||
WBStrain00055593 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006805 | |||||||
Transcript | F55C7.7i.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55C7.7i.1:c.4191+1G>T | ||||||||
Intron_number | 16/25 | ||||||||
F55C7.7b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55C7.7b.1:c.4191+1G>T | ||||||||
Intron_number | 16/20 | ||||||||
F55C7.7a.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55C7.7a.1:c.4191+1G>T | ||||||||
Intron_number | 17/33 | ||||||||
F55C7.7i.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55C7.7i.2:c.4191+1G>T | ||||||||
Intron_number | 16/24 | ||||||||
Interactor (13) | |||||||||
Isolation | Mutagen | 32P | |||||||
Genetics | Interpolated_map_position | I | -1.85907 | ||||||
Mapping_data | In_2_point | 6 | |||||||
3200 | |||||||||
In_multi_point | 20 | ||||||||
966 | |||||||||
967 | |||||||||
1219 | |||||||||
1682 | |||||||||
1683 | |||||||||
1759 | |||||||||
1761 | |||||||||
1763 | |||||||||
In_pos_neg_data (17) | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 34 | 34 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000016 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000093 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | occasional lineage defects | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in unc-73 also blocked the Q migrations and disrupted the polarized leading processes (Fig. 3I-M). In animals carrying the weak unc-73 allele e936, 6% of the QL cells were unpolarized and 9% of the QR cells were unpolarized. In animals containing the stronger unc-73 allele, gm33, 24% of QL cells and 26% of QR cells were unpolarized." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0030010 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00001105 | |||||||
WBPaper00031671 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons are posteriorly misdirected and never reach the nerve ring | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Both branches of the NSM major process are often either absent or show premature termination in the unc-73 mutant. In this mutant, 27% of the dorsal processes and 10% of the sub-ventral processes are absent. | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 6 | 6 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00046150 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Distal tip cells (DTCs) overshoot the vulval region because of a defect in cessation of their migration. | Paper_evidence | WBPaper00046150 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00046150 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00032941 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | e936 mutation frequently resulted in defective ALM and CAN migration | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibited reduced or lost expression of MAB-5 protein in QL descendants, as determined by antibody staining (Figure 6E) | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007274 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007276 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000443 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Male copulatory spicules short and crumpled. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that mutations in unc-40, dpy-19 and unc-73 prevent the Q cells from migrating. We quantified the extent of these migrations by measuring the separation of the Q cell nuclei along the A/P axis at 2.5-3.5 hours. At this time in wild-type animals, the Q cells have moved approximately 25 μm apart from one another. By contrast, in unc-40, dpy-19 and unc-73 mutants, QL and QR are still in similar A/P positions (Fig. 2)." (also Figure 6E, 7) | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"At a lower frequency, the QL and QR descendants were misplaced in unc-73 mutants (Fig. 7 and Way et al., 1992)." | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs fail to arrive at their final destination (between P5/6 and V4) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00032941 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | e936 mutation frequently resulted in defective ALM and CAN migration | Paper_evidence | WBPaper00032941 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00032941 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ES3 ME0 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000571 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Synaptic vesicles are misaccumulated in GABAergic D-type motor neurons as assayed by gaps in the pattern of fluorescence of juIs1[Punc-25::SNB-1::GFP] labeled vesicles. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dumpyish | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000594 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | reduced Z migration | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | inactive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001105 | |||||||
WBPaper00032907 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable defects in axon growth and fasciculation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000944 | Paper_evidence | WBPaper00049729 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | Figure 1, PLM anterior neurite was shortened in the mutants in the mutants. | Paper_evidence | WBPaper00049729 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00049729 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
GO_term | GO:0043005 | PATO:0002364 | Paper_evidence | WBPaper00049729 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show ventral blocks (failure to extend ventrally from their cell bodies to the ventral cord) and anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 51 percent of mutants have ventral blocks and 37 percent have anterior blocks | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001105 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001226 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit commissural axon guidance defects. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001404 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibited ectopic expression of MAB-5 protein in QR descendants, as determined by antibody staining (Figure 6E) | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007279 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007281 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001767 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | commissures often on wrong side | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit fewer dorsal and ventral muscle arms than control. This defect can be rescued by muscle-expressed UNC-73, but not by neuronal-expressed UNC-73. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00040813 | |||||||
Curator_confirmed | WBPerson2706 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Models_disease | DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000553 | ||||||||
Reference (35) | |||||||||
Method | Substitution_allele |