WormBase Tree Display for Variation: WBVar00143587
expand all nodes | collapse all nodes | view schema
| WBVar00143587 | Evidence | Paper_evidence | WBPaper00027361 | ||
|---|---|---|---|---|---|
| Name | Public_name | e907 | |||
| HGVSg | CHROMOSOME_I:g.5432095_5433104del | ||||
| Sequence_details | SMap | S_parent | Sequence | F27C1 | |
| Flanking_sequences | caaattagaagcttttcctttttcttttga | ctgaaagacgtaagggagttcgcgccttta | |||
| Mapping_target | F27C1 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (1986) | |||||
| Laboratory | CB | ||||
| BC | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00001067 | |||
| Transcript | F27C1.8.1 | VEP_consequence | transcript_ablation | ||
| VEP_impact | HIGH | ||||
| Exon_number | 1/1 | ||||
| Genetics | Interpolated_map_position | I | -0.000157525 | ||
| Reference | WBPaper00015468 | ||||
| WBPaper00027361 | |||||
| WBPaper00013926 | |||||
| WBPaper00018210 | |||||
| WBPaper00025514 | |||||
| WBPaper00061175 | |||||
| WBPaper00065747 | |||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
| Method | Deletion_allele |
