WormBase Tree Display for Variation: WBVar00143490
expand all nodes | collapse all nodes | view schema
WBVar00143490 | Evidence | Paper_evidence | WBPaper00005177 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e794 | |||||||
Other_name | CE20819:p.Pro20ThrfsTer12 | ||||||||
F46E10.9.2:c.54dup | |||||||||
F46E10.9.1:c.54dup | |||||||||
HGVSg | CHROMOSOME_V:g.6513291dup | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46E10 | |||||
Flanking_sequences | ctcggacttttcgccgttggagtctcgggg | ggacctaccagatcttccaagctcgtcttt | |||||||
Mapping_target | F46E10 | ||||||||
Type_of_mutation | Insertion | g | Paper_evidence | WBPaper00005177 | |||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001073 | |||||||
Transcript (2) | |||||||||
Isolation | Mutagen | ICR191 acridine | |||||||
Genetics | Gene_class | unc | |||||||
Interpolated_map_position | V | -0.00140555 | |||||||
Description | Phenotype | WBPhenotype:0000505 | Paper_evidence | WBPaper00005177 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." | Paper_evidence | WBPaper00005177 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0048666 | PATO:0000460 | Paper_evidence | WBPaper00005177 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00005177 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." | Paper_evidence | WBPaper00005177 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00005177 | ||||||||
Method | Insertion_allele |