WormBase Tree Display for Variation: WBVar00143458
expand all nodes | collapse all nodes | view schema
WBVar00143458 | Evidence | Paper_evidence | WBPaper00006395 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e754 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_V:g.8231332C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C16D9 | |||||
Flanking_sequences | gagactagaattaataaaaccgcagaatgg | agattgctgaaagaggattagatggatgga | |||||||
Mapping_target | C16D9 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004203 | ||||||||
WBStrain00005459 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004395 | |||||||
Transcript | C16D9.2.1 (12) | ||||||||
Interactor | WBInteraction000052483 | ||||||||
WBInteraction000052510 | |||||||||
WBInteraction000052511 | |||||||||
WBInteraction000052518 | |||||||||
WBInteraction000052521 | |||||||||
Genetics | Interpolated_map_position | V | 1.24752 | ||||||
Mapping_data | In_2_point | 128 | |||||||
In_multi_point | 156 | ||||||||
1160 | |||||||||
2434 | |||||||||
3160 | |||||||||
3161 | |||||||||
3162 | |||||||||
3214 | |||||||||
3215 | |||||||||
3508 | |||||||||
In_pos_neg_data | 302 | ||||||||
862 | |||||||||
1762 | |||||||||
2866 | |||||||||
2867 | |||||||||
2868 | |||||||||
2869 | |||||||||
Description | Phenotype | WBPhenotype:0000501 | Paper_evidence | WBPaper00000465 | |||||
WBPaper00000906 | |||||||||
WBPaper00001474 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adults left-handed rollers. Easy to score (ES3) in adult. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00000906 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000645 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make a 1/4 turn along the length of the cuticle. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00001474 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00017146 | ||||||||
WBPaper00042458 | |||||||||
WBPaper00021063 | |||||||||
WBPaper00014316 | |||||||||
WBPaper00001474 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00000465 | |||||||||
WBPaper00014527 | |||||||||
WBPaper00000906 | |||||||||
Method | Substitution_allele |