WormBase Tree Display for Variation: WBVar00143456

WBVar00143456 Evidence: Paper_evidence: WBPaper00005177
  Name: Public_name: e752
    Other_name: F46E10.9.1:c.149G>A
      F46E10.9.2:c.149G>A
      CE20819:p.Trp50Ter
    HGVSg: CHROMOSOME_V:g.6512871C>T
  Sequence_details: SMap: S_parent: Sequence: F46E10
    Flanking_sequences: ataacttttaaaattccagccatgctccat gtgcccagcttgcaaggatcttcaaaaagc
    Mapping_target: F46E10
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00005177
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001073
    Transcript: F46E10.9.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F46E10.9.2:c.149G>A
        HGVSp: CE20819:p.Trp50Ter
        cDNA_position: 303
        CDS_position: 149
        Protein_position: 50
        Exon_number: 4/9
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      F46E10.9.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F46E10.9.1:c.149G>A
        HGVSp: CE20819:p.Trp50Ter
        cDNA_position: 150
        CDS_position: 149
        Protein_position: 50
        Exon_number: 3/8
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
  Genetics: Interpolated_map_position: V -0.00633084
  Description: Phenotype: WBPhenotype:0000505 Paper_evidence: WBPaper00005177
        Curator_confirmed: WBPerson2987
        Remark: "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." Paper_evidence: WBPaper00005177
            Curator_confirmed: WBPerson2987
        EQ_annotations: GO_term: GO:0048666 PATO:0000460 Paper_evidence: WBPaper00005177
                Curator_confirmed: WBPerson2987
      WBPhenotype:0000583 Paper_evidence: WBPaper00005177
        Curator_confirmed: WBPerson2987
        Remark: "Strong Dpy and Ram phenotypes were found in e33, e207, e504, e752, e794, e1180 and s261 alleles (Fig. 1 B, J)." Paper_evidence: WBPaper00005177
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00005177
  Method: Substitution_allele