WormBase Tree Display for Variation: WBVar00143414
expand all nodes | collapse all nodes | view schema
WBVar00143414 | Evidence (2) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e698 | |||||||
Other_name (17) | |||||||||
HGVSg | CHROMOSOME_I:g.11770152G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1151 | |||||
Flanking_sequences | tctcgagagcattggcgagagaagttggtg | aagcttcatgatcttctccttgatgagctt | |||||||
Mapping_target | ZK1151 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004199 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006876 | |||||||
Transcript (11) | |||||||||
Interactor (16) | |||||||||
Genetics | Interpolated_map_position | I | 9.61491 | ||||||
Mapping_data | In_2_point | 646 | |||||||
647 | |||||||||
In_multi_point | 566 | ||||||||
567 | |||||||||
Description | Phenotype | WBPhenotype:0000030 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | generally poor growth | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000071 | Paper_evidence | WBPaper00040080 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000474 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mua (defective muscle attachment). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001099 | Paper_evidence | WBPaper00038193 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | adults have a twisted nose | Paper_evidence | WBPaper00038193 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0001294 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | degenerate head, bent dorsally or ventrally; penetrance 50%; scoring easy to difficult (ES3/1). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001297 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adult male tail invariably thin fan and rays reduced in size | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | 50% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00046146 | |||||||
Curator_confirmed | WBPerson12329 | ||||||||
WBPhenotype:0002534 | Paper_evidence | WBPaper00031865 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited significanlty less activation of lys-8, clec-85, dod-22, F55G11.7 and K08D8.5 and higher activation of abf-1 and abf-3 gene expression compared to wild-type animals as determined by qPCR. | Paper_evidence | WBPaper00031865 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00031865 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not have altered susceptibility to P. aeruginosa at 15C or 25C. | Paper_evidence | WBPaper00031865 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were exposed to P. aeruginosa starting at L4 stage. | Paper_evidence | WBPaper00031865 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00031865 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038193 | ||||||||
WBPaper00040080 | |||||||||
WBPaper00001328 | |||||||||
WBPaper00031865 | |||||||||
WBPaper00011329 | |||||||||
WBPaper00046146 | |||||||||
Method | Substitution_allele |