WormBase Tree Display for Variation: WBVar00143343
expand all nodes | collapse all nodes | view schema
WBVar00143343 | Name | Public_name | e620 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C16B8.1.1:c.313C>T | ||||||||
CE44782:p.Gln105Ter | |||||||||
HGVSg | CHROMOSOME_X:g.3959108C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C16B8 | |||||
Flanking_sequences | ccattgaaaggaacggtgccagaatctttg | agggtattcatttcgcgaaacatttttcaa | |||||||
Mapping_target | C16B8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024383 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004187 | ||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
WBStrain00026854 | |||||||||
WBStrain00026896 | |||||||||
WBStrain00027230 | |||||||||
WBStrain00030926 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003007 | |||||||
Transcript | C16B8.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C16B8.1.1:c.313C>T | ||||||||
HGVSp | CE44782:p.Gln105Ter | ||||||||
cDNA_position | 321 | ||||||||
CDS_position | 313 | ||||||||
Protein_position | 105 | ||||||||
Exon_number | 4/14 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (43) | |||||||||
Genetics | Interpolated_map_position | X | -8.86883 | ||||||
Mapping_data | In_multi_point (15) | ||||||||
In_pos_neg_data | 5833 | ||||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The lin-18(e620) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nerve ring development is normal | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001024 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males phenotypically wildtype. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031110 | ||||||||
WBPaper00004436 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00035405 | |||||||||
WBPaper00024383 | |||||||||
WBPaper00000762 | |||||||||
WBPaper00024693 | |||||||||
WBPaper00014324 | |||||||||
WBPaper00023511 | |||||||||
WBPaper00015472 | |||||||||
WBPaper00015594 | |||||||||
WBPaper00044058 | |||||||||
WBPaper00044679 | |||||||||
WBPaper00057191 | |||||||||
WBPaper00060654 | |||||||||
Method | Substitution_allele |