WormBase Tree Display for Variation: WBVar00143305

WBVar00143305 Evidence: Paper_evidence: WBPaper00004275
  Name: Public_name: e568
    Other_name: CE29050:p.Arg799Ter
      JC8.10a.1:c.2377C>T
      JC8.10b.1:c.2395C>T
      CE28239:p.Arg793Ter
    HGVSg: CHROMOSOME_IV:g.13263980G>A
  Sequence_details: SMap: S_parent: Sequence: JC8
    Flanking_sequences: gaaaagtgtcgtgcacccgcatggactgat gaattctttggaaagatcagagaaagaagg
    Mapping_target: JC8
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006763
    Transcript: JC8.10b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.10b.1:c.2395C>T
        HGVSp: CE29050:p.Arg799Ter
        cDNA_position: 2400
        CDS_position: 2395
        Protein_position: 799
        Exon_number: 9/12
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
      JC8.10a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.10a.1:c.2377C>T
        HGVSp: CE28239:p.Arg793Ter
        cDNA_position: 2380
        CDS_position: 2377
        Protein_position: 793
        Exon_number: 8/11
        Codon_change: Cga/Tga
        Amino_acid_change: R/*
  Genetics: Interpolated_map_position: IV 8.5113
  Description: Phenotype: WBPhenotype:0000017 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Moderate allele. unc-26 mutants are resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000210 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Moderate allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000229 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Moderate allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000455 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Moderate allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000565 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Moderate allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000643 Paper_evidence: WBPaper00001303
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited limited movement in the first two larval stages but it progressively improved with age. Paper_evidence: WBPaper00001303
            Curator_confirmed: WBPerson712
  Reference: WBPaper00004275
    WBPaper00013791
    WBPaper00001303
  Method: Substitution_allele