WormBase Tree Display for Variation: WBVar00143302
expand all nodes | collapse all nodes | view schema
| WBVar00143302 | Evidence | Paper_evidence | WBPaper00027361 | ||
|---|---|---|---|---|---|
| Name | Public_name | e565 | |||
| Sequence_details | SMap | S_parent | Sequence | F27C1 | |
| Flanking_sequences | catctttttccacaataagtgctcatgtgc | tttcctttttcttttgaacttgctaacttt | |||
| Mapping_target | F27C1 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001067 | |||
| Genetics | Interpolated_map_position | I | 0.000268718 | ||
| Reference | WBPaper00015468 | ||||
| WBPaper00013926 | |||||
| Remark | Mutation lies upstream of gene. | ||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001067 Genomic_neighbourhood | Paper_evidence | WBPaper00027361 | |||
| Method | Deletion_allele |
