WormBase Tree Display for Variation: WBVar00143270
expand all nodes | collapse all nodes | view schema
| WBVar00143270 | Evidence | Person_evidence | WBPerson10095 | ||
|---|---|---|---|---|---|
| Name | Public_name | e519 | |||
| Other_name | CE29928:p.Arg74Cys | ||||
| Y73B6BL.34.1:c.220C>T | |||||
| HGVSg | CHROMOSOME_IV:g.6377434C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | Y73B6BL | |
| Flanking_sequences | gtctcctcgatccgttccaaccgtaccgcc | gtcaagcttcttacggagattctggtgccg | |||
| Mapping_target | Y73B6BL | ||||
| Type_of_mutation | Substitution | c | t | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00051524 | ||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00000256 | |||
| Transcript | Y73B6BL.34.1 (12) | ||||
| Genetics | Gene_class | bli | |||
| Interpolated_map_position | IV | 3.18865 | |||
| Remark | alt_det = c to t mut_det = R74C | Person_evidence | WBPerson10095 | ||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson10095 on 2022-02-17_15:58:20 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Method | Substitution_allele |
