WormBase Tree Display for Variation: WBVar00143233
expand all nodes | collapse all nodes | view schema
WBVar00143233 | Evidence | Paper_evidence | WBPaper00004985 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e464 | |||||
Other_name | CE17307:p.Gly103Arg | ||||||
ZC416.8a.1:c.307G>C | |||||||
ZC416.8b.1:c.-1+1467G>C | |||||||
HGVSg | CHROMOSOME_IV:g.3623165C>G | ||||||
Sequence_details | SMap | S_parent | Sequence | ZC416 | |||
Flanking_sequences | attaactttttggatgaggagctggaattg | gatggctcttcgcttcaaaagctttgctgc | |||||
Mapping_target | ZC416 | ||||||
Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00004985 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006756 | |||||
WBGene00000481 | |||||||
Transcript (2) | |||||||
Genetics | Interpolated_map_position | IV | -3.08612 | ||||
Mapping_data | In_2_point | 316 | |||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||
Curator_confirmed | WBPerson48 | ||||||
WBPhenotype:0001296 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00000031 | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006756 Missense 103 G to R Inferred_automatically map_Alleles.pl | ||||||
Method | Substitution_allele |