WormBase Tree Display for Variation: WBVar00143220

WBVar00143220 Evidence: Paper_evidence: WBPaper00040589
  Name: Public_name: e450
    Other_name (18)
    HGVSg: CHROMOSOME_I:g.7435173C>T
  Sequence_details: SMap: S_parent: Sequence: C44E1
    Flanking_sequences: attcaagaagaagaggaaaaaaggaattat aggaactttggcataatgcttacaagagag
    Mapping_target: C44E1
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00040589
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (205)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006752
    Transcript (9)
    Interactor: WBInteraction000518876
      WBInteraction000519037
      WBInteraction000536820
      WBInteraction000536821
  Genetics: Interpolated_map_position: I 2.07407
    Mapping_data: In_2_point (14)
      In_multi_point (75)
      In_pos_neg_data (45)
  Description: Phenotype: WBPhenotype:0000002 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000017 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000020 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000039 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: rab-3p::xbp-1s Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000229 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000359 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: rab-3p::xbp-1s Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000507 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: high acetylcholine levels, similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000604 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: variable neuroanatomical defects, similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0000644 Person_evidence: WBPerson261
        Curator_confirmed: WBPerson712
        Remark: similar to e51 or slightly weaker Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001278 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "When crossed with unc-13(e450), cell-nonautonomous UPR-ER activation in the intestine of rab-3p::xbp-1s; hsp-4p::GFP animals was reduced, but autonomous activation of the UPR-ER in the nervous system remained intact (Figures 7B and S6E)." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        EQ_annotations: Anatomy_term: WBbt:0005772 PATO:0000460 Paper_evidence: WBPaper00042524
                Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: rab-3p::xbp-1s; hsp-4p::GFP Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000306 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "unc-13(e450) animals could activate the UPR-ER in the intestine upon expression of gly-19::xbp-1s, indicating that the ability to activate the UPR-ER cell autonomously in an unc-13(e450) mutant background was not lost (Figures S6F and S6G)." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gly-19::xbp-1s; hsp-4p::GFP Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001661 Paper_evidence: WBPaper00003760
        Curator_confirmed: WBPerson2021
        Remark: Asymmetric expression in AWC was normal Paper_evidence: WBPaper00003760
            Curator_confirmed: WBPerson2021
  Reference (17)
  Method: Substitution_allele