WormBase Tree Display for Variation: WBVar00143220

WBVar00143220 Evidence: Paper_evidence: WBPaper00040589
  Name: Public_name: e450
    Other_name (18)
    HGVSg: CHROMOSOME_I:g.7435173C>T
  Sequence_details: SMap: S_parent: Sequence: C44E1
    Flanking_sequences: attcaagaagaagaggaaaaaaggaattat aggaactttggcataatgcttacaagagag
    Mapping_target: C44E1
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00040589
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (205)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006752
    Transcript (9)
    Interactor: WBInteraction000518876
      WBInteraction000519037
      WBInteraction000536820
      WBInteraction000536821
  Genetics: Interpolated_map_position: I 2.07407
    Mapping_data: In_2_point (14)
      In_multi_point (75)
      In_pos_neg_data (45)
  Description: Phenotype (10)
    Phenotype_not_observed: WBPhenotype:0000306 Paper_evidence: WBPaper00042524
        Curator_confirmed: WBPerson2987
        Remark: "unc-13(e450) animals could activate the UPR-ER in the intestine upon expression of gly-19::xbp-1s, indicating that the ability to activate the UPR-ER cell autonomously in an unc-13(e450) mutant background was not lost (Figures S6F and S6G)." Paper_evidence: WBPaper00042524
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gly-19::xbp-1s; hsp-4p::GFP Paper_evidence: WBPaper00042524
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001661 Paper_evidence: WBPaper00003760
        Curator_confirmed: WBPerson2021
        Remark: Asymmetric expression in AWC was normal Paper_evidence: WBPaper00003760
            Curator_confirmed: WBPerson2021
  Reference (17)
  Method: Substitution_allele