WormBase Tree Display for Variation: WBVar00143220
expand all nodes | collapse all nodes | view schema
WBVar00143220 | Evidence | Paper_evidence | WBPaper00040589 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | ||||
Flanking_sequences | attcaagaagaagaggaaaaaaggaattat | aggaactttggcataatgcttacaagagag | ||||||
Mapping_target | C44E1 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00040589 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (205) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006752 | ||||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2e.1:c.1768C>T | |||||||
HGVSp | CE34626:p.Gln590Ter | |||||||
cDNA_position | 1768 | |||||||
CDS_position | 1768 | |||||||
Protein_position | 590 | |||||||
Exon_number | 13/30 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2c.1:c.745C>T | |||||||
HGVSp | CE34624:p.Gln249Ter | |||||||
cDNA_position | 745 | |||||||
CDS_position | 745 | |||||||
Protein_position | 249 | |||||||
Exon_number | 5/22 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2f.1:c.1777C>T | |||||||
HGVSp | CE43866:p.Gln593Ter | |||||||
cDNA_position | 1777 | |||||||
CDS_position | 1777 | |||||||
Protein_position | 593 | |||||||
Exon_number | 13/30 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2j.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2j.1:c.1732C>T | |||||||
HGVSp | CE51718:p.Gln578Ter | |||||||
cDNA_position | 1732 | |||||||
CDS_position | 1732 | |||||||
Protein_position | 578 | |||||||
Exon_number | 13/29 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2k.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2k.1:c.1723C>T | |||||||
HGVSp | CE51726:p.Gln575Ter | |||||||
cDNA_position | 1723 | |||||||
CDS_position | 1723 | |||||||
Protein_position | 575 | |||||||
Exon_number | 13/29 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2a.1:c.1768C>T | |||||||
HGVSp | CE15371:p.Gln590Ter | |||||||
cDNA_position | 1768 | |||||||
CDS_position | 1768 | |||||||
Protein_position | 590 | |||||||
Exon_number | 13/30 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2i.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2i.1:c.1777C>T | |||||||
HGVSp | CE32552:p.Gln593Ter | |||||||
cDNA_position | 1777 | |||||||
CDS_position | 1777 | |||||||
Protein_position | 593 | |||||||
Exon_number | 13/29 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2d.1:c.1768C>T | |||||||
HGVSp | CE34625:p.Gln590Ter | |||||||
cDNA_position | 1768 | |||||||
CDS_position | 1768 | |||||||
Protein_position | 590 | |||||||
Exon_number | 13/31 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
ZK524.2h.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2h.1:c.745C>T | |||||||
HGVSp | CE51759:p.Gln249Ter | |||||||
cDNA_position | 745 | |||||||
CDS_position | 745 | |||||||
Protein_position | 249 | |||||||
Exon_number | 5/21 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000518876 | |||||||
WBInteraction000519037 | ||||||||
WBInteraction000536820 | ||||||||
WBInteraction000536821 | ||||||||
Genetics | Interpolated_map_position | I | 2.07407 | |||||
Mapping_data | In_2_point (14) | |||||||
In_multi_point (75) | ||||||||
In_pos_neg_data (45) | ||||||||
Description | Phenotype (10) | |||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "unc-13(e450) animals could activate the UPR-ER in the intestine upon expression of gly-19::xbp-1s, indicating that the ability to activate the UPR-ER cell autonomously in an unc-13(e450) mutant background was not lost (Figures S6F and S6G)." | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | gly-19::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (17) | ||||||||
Method | Substitution_allele |