WormBase Tree Display for Variation: WBVar00143220
expand all nodes | collapse all nodes | view schema
WBVar00143220 | Evidence | Paper_evidence | WBPaper00040589 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e450 | |||||||
Other_name (18) | |||||||||
HGVSg | CHROMOSOME_I:g.7435173C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | |||||
Flanking_sequences | attcaagaagaagaggaaaaaaggaattat | aggaactttggcataatgcttacaagagag | |||||||
Mapping_target | C44E1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00040589 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (205) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006752 | |||||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2e.1:c.1768C>T | ||||||||
HGVSp | CE34626:p.Gln590Ter | ||||||||
cDNA_position | 1768 | ||||||||
CDS_position | 1768 | ||||||||
Protein_position | 590 | ||||||||
Exon_number | 13/30 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2c.1:c.745C>T | ||||||||
HGVSp | CE34624:p.Gln249Ter | ||||||||
cDNA_position | 745 | ||||||||
CDS_position | 745 | ||||||||
Protein_position | 249 | ||||||||
Exon_number | 5/22 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2f.1:c.1777C>T | ||||||||
HGVSp | CE43866:p.Gln593Ter | ||||||||
cDNA_position | 1777 | ||||||||
CDS_position | 1777 | ||||||||
Protein_position | 593 | ||||||||
Exon_number | 13/30 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2j.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2j.1:c.1732C>T | ||||||||
HGVSp | CE51718:p.Gln578Ter | ||||||||
cDNA_position | 1732 | ||||||||
CDS_position | 1732 | ||||||||
Protein_position | 578 | ||||||||
Exon_number | 13/29 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2k.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2k.1:c.1723C>T | ||||||||
HGVSp | CE51726:p.Gln575Ter | ||||||||
cDNA_position | 1723 | ||||||||
CDS_position | 1723 | ||||||||
Protein_position | 575 | ||||||||
Exon_number | 13/29 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2a.1:c.1768C>T | ||||||||
HGVSp | CE15371:p.Gln590Ter | ||||||||
cDNA_position | 1768 | ||||||||
CDS_position | 1768 | ||||||||
Protein_position | 590 | ||||||||
Exon_number | 13/30 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2i.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2i.1:c.1777C>T | ||||||||
HGVSp | CE32552:p.Gln593Ter | ||||||||
cDNA_position | 1777 | ||||||||
CDS_position | 1777 | ||||||||
Protein_position | 593 | ||||||||
Exon_number | 13/29 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2d.1:c.1768C>T | ||||||||
HGVSp | CE34625:p.Gln590Ter | ||||||||
cDNA_position | 1768 | ||||||||
CDS_position | 1768 | ||||||||
Protein_position | 590 | ||||||||
Exon_number | 13/31 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZK524.2h.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK524.2h.1:c.745C>T | ||||||||
HGVSp | CE51759:p.Gln249Ter | ||||||||
cDNA_position | 745 | ||||||||
CDS_position | 745 | ||||||||
Protein_position | 249 | ||||||||
Exon_number | 5/21 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000518876 | ||||||||
WBInteraction000519037 | |||||||||
WBInteraction000536820 | |||||||||
WBInteraction000536821 | |||||||||
Genetics | Interpolated_map_position | I | 2.07407 | ||||||
Mapping_data | In_2_point (14) | ||||||||
In_multi_point (75) | |||||||||
In_pos_neg_data (45) | |||||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000020 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00042524 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | rab-3p::xbp-1s | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000359 | Paper_evidence | WBPaper00042524 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | rab-3p::xbp-1s | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000507 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | high acetylcholine levels, similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | variable neuroanatomical defects, similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00042524 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "When crossed with unc-13(e450), cell-nonautonomous UPR-ER activation in the intestine of rab-3p::xbp-1s; hsp-4p::GFP animals was reduced, but autonomous activation of the UPR-ER in the nervous system remained intact (Figures 7B and S6E)." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00042524 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | rab-3p::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "unc-13(e450) animals could activate the UPR-ER in the intestine upon expression of gly-19::xbp-1s, indicating that the ability to activate the UPR-ER cell autonomously in an unc-13(e450) mutant background was not lost (Figures S6F and S6G)." | Paper_evidence | WBPaper00042524 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gly-19::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00016541 | ||||||||
WBPaper00016542 | |||||||||
WBPaper00040589 | |||||||||
WBPaper00029020 | |||||||||
WBPaper00014587 | |||||||||
WBPaper00016498 | |||||||||
WBPaper00016569 | |||||||||
WBPaper00013927 | |||||||||
WBPaper00003760 | |||||||||
WBPaper00016086 | |||||||||
WBPaper00013745 | |||||||||
WBPaper00016275 | |||||||||
WBPaper00013815 | |||||||||
WBPaper00013819 | |||||||||
WBPaper00042524 | |||||||||
WBPaper00064979 | |||||||||
WBPaper00065802 | |||||||||
Method | Substitution_allele |