WormBase Tree Display for Variation: WBVar00143220
expand all nodes | collapse all nodes | view schema
| WBVar00143220 | Evidence | Paper_evidence | WBPaper00040589 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e450 | |||||||
| Other_name (18) | |||||||||
| HGVSg | CHROMOSOME_I:g.7435173C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C44E1 | |||||
| Flanking_sequences | attcaagaagaagaggaaaaaaggaattat | aggaactttggcataatgcttacaagagag | |||||||
| Mapping_target | C44E1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00040589 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (205) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006752 | |||||||
| Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2e.1:c.1768C>T | ||||||||
| HGVSp | CE34626:p.Gln590Ter | ||||||||
| cDNA_position | 1768 | ||||||||
| CDS_position | 1768 | ||||||||
| Protein_position | 590 | ||||||||
| Exon_number | 13/30 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2c.1:c.745C>T | ||||||||
| HGVSp | CE34624:p.Gln249Ter | ||||||||
| cDNA_position | 745 | ||||||||
| CDS_position | 745 | ||||||||
| Protein_position | 249 | ||||||||
| Exon_number | 5/22 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2f.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2f.1:c.1777C>T | ||||||||
| HGVSp | CE43866:p.Gln593Ter | ||||||||
| cDNA_position | 1777 | ||||||||
| CDS_position | 1777 | ||||||||
| Protein_position | 593 | ||||||||
| Exon_number | 13/30 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2j.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2j.1:c.1732C>T | ||||||||
| HGVSp | CE51718:p.Gln578Ter | ||||||||
| cDNA_position | 1732 | ||||||||
| CDS_position | 1732 | ||||||||
| Protein_position | 578 | ||||||||
| Exon_number | 13/29 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2k.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2k.1:c.1723C>T | ||||||||
| HGVSp | CE51726:p.Gln575Ter | ||||||||
| cDNA_position | 1723 | ||||||||
| CDS_position | 1723 | ||||||||
| Protein_position | 575 | ||||||||
| Exon_number | 13/29 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2a.1:c.1768C>T | ||||||||
| HGVSp | CE15371:p.Gln590Ter | ||||||||
| cDNA_position | 1768 | ||||||||
| CDS_position | 1768 | ||||||||
| Protein_position | 590 | ||||||||
| Exon_number | 13/30 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2i.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2i.1:c.1777C>T | ||||||||
| HGVSp | CE32552:p.Gln593Ter | ||||||||
| cDNA_position | 1777 | ||||||||
| CDS_position | 1777 | ||||||||
| Protein_position | 593 | ||||||||
| Exon_number | 13/29 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2d.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2d.1:c.1768C>T | ||||||||
| HGVSp | CE34625:p.Gln590Ter | ||||||||
| cDNA_position | 1768 | ||||||||
| CDS_position | 1768 | ||||||||
| Protein_position | 590 | ||||||||
| Exon_number | 13/31 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| ZK524.2h.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | ZK524.2h.1:c.745C>T | ||||||||
| HGVSp | CE51759:p.Gln249Ter | ||||||||
| cDNA_position | 745 | ||||||||
| CDS_position | 745 | ||||||||
| Protein_position | 249 | ||||||||
| Exon_number | 5/21 | ||||||||
| Codon_change | Cag/Tag | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000518876 | ||||||||
| WBInteraction000519037 | |||||||||
| WBInteraction000536820 | |||||||||
| WBInteraction000536821 | |||||||||
| Genetics | Interpolated_map_position | I | 2.07407 | ||||||
| Mapping_data | In_2_point (14) | ||||||||
| In_multi_point | 31 | ||||||||
| 37 | |||||||||
| 238 | |||||||||
| 239 | |||||||||
| 240 | |||||||||
| 979 | |||||||||
| 997 | |||||||||
| 1004 | |||||||||
| 1005 | |||||||||
| 1006 | |||||||||
| 1007 | |||||||||
| 1008 | |||||||||
| 1009 | |||||||||
| 1010 | |||||||||
| 1011 | |||||||||
| 1012 | |||||||||
| 1013 | |||||||||
| 1014 | |||||||||
| 1015 | |||||||||
| 1016 | |||||||||
| 1017 | |||||||||
| 1018 | |||||||||
| 1019 | |||||||||
| 1020 | |||||||||
| 1021 | |||||||||
| 1022 | |||||||||
| 1023 | |||||||||
| 1024 | |||||||||
| 1025 | |||||||||
| 1026 | |||||||||
| 1027 | |||||||||
| 1028 | |||||||||
| 1029 | |||||||||
| 1030 | |||||||||
| 1031 | |||||||||
| 1032 | |||||||||
| 1033 | |||||||||
| 1034 | |||||||||
| 1035 | |||||||||
| 1036 | |||||||||
| 1037 | |||||||||
| 1038 | |||||||||
| 1039 | |||||||||
| 1040 | |||||||||
| 1041 | |||||||||
| 1042 | |||||||||
| 1224 | |||||||||
| 1225 | |||||||||
| 1226 | |||||||||
| 1241 | |||||||||
| 1451 | |||||||||
| 1452 | |||||||||
| 1454 | |||||||||
| 1455 | |||||||||
| 1456 | |||||||||
| 1462 | |||||||||
| 1463 | |||||||||
| 1464 | |||||||||
| 1466 | |||||||||
| 2139 | |||||||||
| 2140 | |||||||||
| 2141 | |||||||||
| 2142 | |||||||||
| 2143 | |||||||||
| 2144 | |||||||||
| 2145 | |||||||||
| 2146 | |||||||||
| 2147 | |||||||||
| 2148 | |||||||||
| 2149 | |||||||||
| 2150 | |||||||||
| 2299 | |||||||||
| 3307 | |||||||||
| 3308 | |||||||||
| 3310 | |||||||||
| In_pos_neg_data (45) | |||||||||
| Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000017 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000020 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000039 | Paper_evidence | WBPaper00042524 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | rab-3p::xbp-1s | Paper_evidence | WBPaper00042524 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000359 | Paper_evidence | WBPaper00042524 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that rab-3p::xbp-1s expression increased neither lifespan nor ER stress resistance in a unc-13(e450) mutant background, strongly suggesting that communication between neurons and intestine through release of SCVs is essential for increased lifespan and stress resistance downstream of neuronal xbp-1s expression (Figures 7C and 7D). However, it should be noted that unc-13(e450) itself increases lifespan, complicating the interpretation of longevity data, and that as the mutation was not specific to neurons, loss of unc-13 activity in other tissues may have contributed to this loss of longevity and stress resistance." | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | rab-3p::xbp-1s | Paper_evidence | WBPaper00042524 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000507 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | high acetylcholine levels, similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | variable neuroanatomical defects, similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | similar to e51 or slightly weaker | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001278 | Paper_evidence | WBPaper00042524 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "When crossed with unc-13(e450), cell-nonautonomous UPR-ER activation in the intestine of rab-3p::xbp-1s; hsp-4p::GFP animals was reduced, but autonomous activation of the UPR-ER in the nervous system remained intact (Figures 7B and S6E)." | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00042524 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | rab-3p::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000306 | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "unc-13(e450) animals could activate the UPR-ER in the intestine upon expression of gly-19::xbp-1s, indicating that the ability to activate the UPR-ER cell autonomously in an unc-13(e450) mutant background was not lost (Figures S6F and S6G)." | Paper_evidence | WBPaper00042524 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | gly-19::xbp-1s; hsp-4p::GFP | Paper_evidence | WBPaper00042524 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Asymmetric expression in AWC was normal | Paper_evidence | WBPaper00003760 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (17) | |||||||||
| Method | Substitution_allele |
