WormBase Tree Display for Variation: WBVar00143216

WBVar00143216 Evidence: Paper_evidence: WBPaper00004275
  Name: Public_name: e446
    Other_name: CE29050:p.Glu623Ter
      JC8.10b.1:c.1867G>T
      CE28239:p.Glu617Ter
      JC8.10a.1:c.1849G>T
    HGVSg: CHROMOSOME_IV:g.13265633C>A
  Sequence_details: SMap: S_parent: Sequence: Y67H2A
    Flanking_sequences: gaaaaagctccatttgtgctcattggctcc agcagctcgtcggtgtttgtctattcctct
    Mapping_target: Y67H2A
    Type_of_mutation: Substitution: g t Paper_evidence: WBPaper00004275
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006763
    Transcript: JC8.10b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.10b.1:c.1867G>T
        HGVSp: CE29050:p.Glu623Ter
        cDNA_position: 1872
        CDS_position: 1867
        Protein_position: 623
        Exon_number: 8/12
        Codon_change: Gag/Tag
        Amino_acid_change: E/*
      JC8.10a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: JC8.10a.1:c.1849G>T
        HGVSp: CE28239:p.Glu617Ter
        cDNA_position: 1852
        CDS_position: 1849
        Protein_position: 617
        Exon_number: 7/11
        Codon_change: Gag/Tag
        Amino_acid_change: E/*
  Genetics: Interpolated_map_position: IV 8.51276
  Description: Phenotype: WBPhenotype:0000017 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000210 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000229 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000455 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
      WBPhenotype:0000565 Paper_evidence: WBPaper00004275
        Curator_confirmed: WBPerson712
        Remark: Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. Paper_evidence: WBPaper00004275
            Curator_confirmed: WBPerson712
  Reference: WBPaper00004275
    WBPaper00013791
  Remark: In addition to the E(623)* described, e446 also has an R(709)T mutation. Paper_evidence: WBPaper00004275
  Method: Substitution_allele