WormBase Tree Display for Variation: WBVar00143214
expand all nodes | collapse all nodes | view schema
WBVar00143214 | Evidence | Person_evidence | WBPerson201 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e444 | |||||||
Other_name (24) | |||||||||
HGVSg | CHROMOSOME_II:g.14657426G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |||||
Flanking_sequences | cttctttccgtggcacctggctcaccagca | gattcaactgtgtcgcgcactcggacactc | |||||||
Mapping_target | ZC101 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson201 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (269) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006787 | |||||||
Transcript (13) | |||||||||
Interactor (4) | |||||||||
Genetics | Interpolated_map_position | II | 23.3112 | ||||||
Mapping_data | In_2_point (13) | ||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data | 1539 | ||||||||
1548 | |||||||||
1551 | |||||||||
2132 | |||||||||
2147 | |||||||||
2156 | |||||||||
2168 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson201 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are partially egg-laying defective. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson201 | |||||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Adults are thin. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are limp. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000473 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | adults limp, paralysed except for head region; thin; Egl; larvae move well; progressive dystrophy, body muscles fail to accumulate myofilaments. Class 1 allele. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 0.8% of sperm have pseudopods, all of which have normal morphology. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000553 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000781 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | body muscles fail to accumulate myofilaments | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000818 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000868 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are paralysed (except for head region). | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed | WBPhenotype:0000060 | Paper_evidence | WBPaper00002086 | ||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Not all class I alleles enhanced the DTC defects of weak unc-5 alleles. For example, unc-52(e444) did not enhance unc-5(e152) (Table 1; P > 0.1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"All class I unc-52 alleles (except e444) strongly enhanced the penetrance of DTC migration defects of a null allele of unc-5 (Table 1)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Larvae move well until early L4 stage. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000027 | PATO:0000460 | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000035 | PATO:0000460 | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000706 | Paper_evidence | WBPaper00025094 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutations did not result in Glo phenotypes | Paper_evidence | WBPaper00025094 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Staining with LysoTracker Red and acridine orange | Paper_evidence | WBPaper00025094 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (22) | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Method | Substitution_allele |