WormBase Tree Display for Variation: WBVar00143196
expand all nodes | collapse all nodes | view schema
WBVar00143196 | Evidence | Paper_evidence | WBPaper00003555 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e419 | ||||||
Other_name | F58E6.10b.1:c.320_321delinsAG | |||||||
CE39164:p.Phe92Ter | ||||||||
F58E6.10e.1:c.167_168delinsAG | ||||||||
CE48350:p.Phe41Ter | ||||||||
CE48409:p.Phe56Ter | ||||||||
F58E6.10d.1:c.122_123delinsAG | ||||||||
CE48141:p.Phe107Ter | ||||||||
F58E6.10a.1:c.275_276delinsAG | ||||||||
HGVSg | CHROMOSOME_V:g.9766966_9766967delinsCT | |||||||
Sequence_details | SMap | S_parent | Sequence | F58E6 | ||||
Flanking_sequences | tcaattccaggcggagacatcggacgacat | actcaggaacaacttcaggagcttgatgct | ||||||
Mapping_target | F58E6 | |||||||
Type_of_mutation | Substitution | tc | ag | Paper_evidence | WBPaper00003555 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004166 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006778 | ||||||
Transcript | F58E6.10e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F58E6.10e.1:c.167_168delinsAG | |||||||
HGVSp | CE48409:p.Phe56Ter | |||||||
cDNA_position | 240-241 | |||||||
CDS_position | 167-168 | |||||||
Protein_position | 56 | |||||||
Exon_number | 4/8 | |||||||
Codon_change | tTC/tAG | |||||||
Amino_acid_change | F/* | |||||||
F58E6.10d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F58E6.10d.1:c.122_123delinsAG | |||||||
HGVSp | CE48350:p.Phe41Ter | |||||||
cDNA_position | 177-178 | |||||||
CDS_position | 122-123 | |||||||
Protein_position | 41 | |||||||
Exon_number | 4/8 | |||||||
Codon_change | tTC/tAG | |||||||
Amino_acid_change | F/* | |||||||
F58E6.10b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F58E6.10b.1:c.320_321delinsAG | |||||||
HGVSp | CE48141:p.Phe107Ter | |||||||
cDNA_position | 407-408 | |||||||
CDS_position | 320-321 | |||||||
Protein_position | 107 | |||||||
Exon_number | 5/9 | |||||||
Codon_change | tTC/tAG | |||||||
Amino_acid_change | F/* | |||||||
F58E6.10a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F58E6.10a.1:c.275_276delinsAG | |||||||
HGVSp | CE39164:p.Phe92Ter | |||||||
cDNA_position | 397-398 | |||||||
CDS_position | 275-276 | |||||||
Protein_position | 92 | |||||||
Exon_number | 5/9 | |||||||
Codon_change | tTC/tAG | |||||||
Amino_acid_change | F/* | |||||||
Interactor | WBInteraction000520814 | |||||||
Genetics | Interpolated_map_position | V | 2.16541 | |||||
Description | Phenotype | WBPhenotype:0000632 | Paper_evidence | WBPaper00002837 | ||||
Curator_confirmed | WBPerson691 | |||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | lin-11 expression in the AVA interneurons is unaltered in unc-42 mutants | Paper_evidence | WBPaper00004906 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | lin-11::gfp | Paper_evidence | WBPaper00004906 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00002837 | |||||||
WBPaper00004906 | ||||||||
Remark | e419 comprises two substitutions of two adjacent bases. | Paper_evidence | WBPaper00003555 | |||||
Method | Substitution_allele |