WormBase Tree Display for Variation: WBVar00143187
expand all nodes | collapse all nodes | view schema
WBVar00143187 | Evidence | Paper_evidence | WBPaper00031105 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e408 | |||||||
Other_name (23) | |||||||||
HGVSg | CHROMOSOME_IV:g.10338170G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | K11E8 | |||||
Flanking_sequences | acggatttgctggaactccaggatacttgt | gccagaagttctcaagaaggatccatactc | |||||||
Mapping_target | K11E8 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031105 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004165 | ||||||||
WBStrain00022482 | |||||||||
WBStrain00030762 | |||||||||
WBStrain00056767 | |||||||||
Laboratory | CB | ||||||||
EN | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006779 | |||||||
Transcript (14) | |||||||||
Interactor | WBInteraction000501679 | ||||||||
Genetics | Interpolated_map_position | IV | 4.5762 | ||||||
Mapping_data | In_multi_point | 764 | |||||||
In_pos_neg_data | 956 | ||||||||
2739 | |||||||||
Description | Phenotype | WBPhenotype:0000004 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000153 | Paper_evidence | WBPaper00002305 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00002305 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000315 | Paper_evidence | WBPaper00046308 | |||||||
Curator_confirmed | WBPerson10425 | ||||||||
WBPhenotype:0000422 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly rippling movement | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tends to shrink and relax when prodded | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00002305 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00042396 | |||||||
Curator_confirmed | WBPerson1687 | ||||||||
Remark | GABAergic neuromuscular junctions (NMJs) are enlarged | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
Recessive | Paper_evidence | WBPaper00042396 | |||||||
Curator_confirmed | WBPerson1687 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00042396 | ||||||
Curator_confirmed | WBPerson1687 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005190 | PATO:0000460 | Paper_evidence | WBPaper00042396 | ||||
Curator_confirmed | WBPerson1687 | ||||||||
GO_term (2) | |||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00002305 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000641 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lazy | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00002305 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson557 | |||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow, easy to score (ES3) in adult. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor backing thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001213 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | almost paralysed, larvae move better | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |