WormBase Tree Display for Variation: WBVar00143187
expand all nodes | collapse all nodes | view schema
WBVar00143187 | Evidence | Paper_evidence | WBPaper00031105 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e408 | ||||||
Other_name (23) | ||||||||
HGVSg | CHROMOSOME_IV:g.10338170G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | K11E8 | ||||
Flanking_sequences | acggatttgctggaactccaggatacttgt | gccagaagttctcaagaaggatccatactc | ||||||
Mapping_target | K11E8 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031105 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004165 | |||||||
WBStrain00022482 | ||||||||
WBStrain00030762 | ||||||||
WBStrain00056767 | ||||||||
Laboratory | CB | |||||||
EN | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006779 | ||||||
Transcript (14) | ||||||||
Interactor | WBInteraction000501679 | |||||||
Genetics | Interpolated_map_position | IV | 4.5762 | |||||
Mapping_data | In_multi_point | 764 | ||||||
In_pos_neg_data | 956 | |||||||
2739 | ||||||||
Description | Phenotype (15) | |||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00040284 | |||||||
WBPaper00000031 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00016234 | ||||||||
WBPaper00015072 | ||||||||
WBPaper00016473 | ||||||||
WBPaper00042396 | ||||||||
WBPaper00002305 | ||||||||
WBPaper00046308 | ||||||||
WBPaper00065298 | ||||||||
WBPaper00066013 | ||||||||
WBPaper00066032 | ||||||||
Method | Substitution_allele |