WormBase Tree Display for Variation: WBVar00143169
expand all nodes | collapse all nodes | view schema
WBVar00143169 | Evidence | Paper_evidence | WBPaper00002050 | ||
---|---|---|---|---|---|
Name | Public_name | e389 | |||
Other_name | CE24516:p.Gln809_Asn823delinsHis | ||||
Y60A3A.1.1:c.2426_2467del | |||||
HGVSg | CHROMOSOME_V:g.19996556_19996597del | ||||
Sequence_details | SMap | S_parent | Sequence | Y60A3A | |
Flanking_sequences | gaaacccccagctgtgcagtcagaggtacc | attgcgatcaggataagacggtgctcacga | |||
Mapping_target | Y60A3A | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00007502 | ||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00006786 | |||
Transcript | Y60A3A.1.1 | VEP_consequence | inframe_deletion | ||
VEP_impact | MODERATE | ||||
HGVSc | Y60A3A.1.1:c.2426_2467del | ||||
HGVSp | CE24516:p.Gln809_Asn823delinsHis | ||||
cDNA_position | 2491-2532 | ||||
CDS_position | 2426-2467 | ||||
Protein_position | 809-823 | ||||
Exon_number | 9/11 | ||||
Codon_change | cAGACCGCCTACATGATGCTTCACACCTTGGCCGAGCAGGTCAat/cat | ||||
Amino_acid_change | QTAYMMLHTLAEQVN/H | ||||
Genetics | Interpolated_map_position | V | 24.4074 | ||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002050 | |
Curator_confirmed | WBPerson48 | ||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00002050 | |||
Curator_confirmed | WBPerson48 | ||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00002050 | |||
Curator_confirmed | WBPerson48 | ||||
Reference | WBPaper00002050 | ||||
Remark | This deletion allele is coupled with an upstream point mutation [801Pro CCC to Thr CTC] | Paper_evidence | WBPaper00002050 | ||
Method | Deletion_allele |