WormBase Tree Display for Variation: WBVar00143159
expand all nodes | collapse all nodes | view schema
WBVar00143159 | Evidence | Paper_evidence | WBPaper00030754 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e375 | |||||
Other_name (34) | |||||||
HGVSg | CHROMOSOME_IV:g.12782539C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK897 | |||
Flanking_sequences | gatgacgaaaatgagcgacatctatgggtc | aggctctgtaccgagccacaggtcaagcct | |||||
Mapping_target | ZK897 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030754 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006767 | |||||
Transcript (17) | |||||||
Genetics | Interpolated_map_position | IV | 6.32069 | ||||
Description | Phenotype | WBPhenotype:0000644 | Paper_evidence | WBPaper00030754 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Contains the same amber suppressible mutation as e375 and e69 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00030754 | ||||||
Method | Substitution_allele |