WormBase Tree Display for Variation: WBVar00143150
expand all nodes | collapse all nodes | view schema
WBVar00143150 | Evidence | Paper_evidence | WBPaper00004203 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e364 | |||||||
Other_name | e364am | ||||||||
CE20261:p.Trp92Ter | |||||||||
Y47D3B.10.1:c.275G>A | |||||||||
HGVSg | CHROMOSOME_III:g.11376127C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3B | |||||
Flanking_sequences | ataaccccacaaatcttcagatctttgact | gaaggagatcgagtcgaaaatgaacgcaaa | |||||||
Mapping_target | Y47D3B | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004203 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (196) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001077 | |||||||
Transcript | Y47D3B.10.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47D3B.10.1:c.275G>A | ||||||||
HGVSp | CE20261:p.Trp92Ter | ||||||||
cDNA_position | 276 | ||||||||
CDS_position | 275 | ||||||||
Protein_position | 92 | ||||||||
Exon_number | 3/9 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000052376 | ||||||||
WBInteraction000537326 | |||||||||
WBInteraction000576800 | |||||||||
Genetics | Interpolated_map_position | III | 8.86179 | ||||||
Mapping_data | In_2_point (46) | ||||||||
In_multi_point (90) | |||||||||
In_pos_neg_data | 1600 | ||||||||
2153 | |||||||||
Description | Phenotype (8) | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 77%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (22) | |||||||||
Method | Substitution_allele |