WormBase Tree Display for Variation: WBVar00143150

WBVar00143150 Evidence: Paper_evidence: WBPaper00004203
  Name: Public_name: e364
    Other_name: e364am
      CE20261:p.Trp92Ter
      Y47D3B.10.1:c.275G>A
    HGVSg: CHROMOSOME_III:g.11376127C>T
  Sequence_details: SMap: S_parent: Sequence: Y47D3B
    Flanking_sequences: ataaccccacaaatcttcagatctttgact gaaggagatcgagtcgaaaatgaacgcaaa
    Mapping_target: Y47D3B
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004203
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (196)
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00001077
    Transcript: Y47D3B.10.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y47D3B.10.1:c.275G>A
        HGVSp: CE20261:p.Trp92Ter
        cDNA_position: 276
        CDS_position: 275
        Protein_position: 92
        Exon_number: 3/9
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
    Interactor: WBInteraction000052376
      WBInteraction000537326
      WBInteraction000576800
  Genetics: Interpolated_map_position: III 8.86179
    Mapping_data: In_2_point (46)
      In_multi_point (90)
      In_pos_neg_data: 1600
        2153
  Description: Phenotype (8)
    Phenotype_not_observed: WBPhenotype:0000648 Paper_evidence: WBPaper00001328
        Curator_confirmed: WBPerson712
        Remark: Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently Paper_evidence: WBPaper00001328
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20C Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
          Genotype: him-5(e1490) Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
      WBPhenotype:0000695 Paper_evidence: WBPaper00001328
        Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006748 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00001328
                Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 20C Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
          Genotype: him-5(e1490) Paper_evidence: WBPaper00001328
              Curator_confirmed: WBPerson712
      WBPhenotype:0000718 Paper_evidence: WBPaper00001011
        Curator_confirmed: WBPerson712
        Remark: Animals have 77%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). Paper_evidence: WBPaper00001011
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were raised at 24C. Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Temperature: 24 Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
          Genotype: lin-14(n179) Paper_evidence: WBPaper00001011
              Curator_confirmed: WBPerson712
      WBPhenotype:0001426 Paper_evidence: WBPaper00004883
        Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: arIs37 Paper_evidence: WBPaper00004883
              Curator_confirmed: WBPerson712
      WBPhenotype:0001732 Paper_evidence: WBPaper00032033
        Curator_confirmed: WBPerson712
        Remark: Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. Paper_evidence: WBPaper00032033
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. Paper_evidence: WBPaper00032033
              Curator_confirmed: WBPerson712
  Reference (22)
  Method: Substitution_allele