WormBase Tree Display for Variation: WBVar00143150
expand all nodes | collapse all nodes | view schema
| WBVar00143150 | Evidence | Paper_evidence | WBPaper00004203 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e364 | |||||||
| Other_name | e364am | ||||||||
| CE20261:p.Trp92Ter | |||||||||
| Y47D3B.10.1:c.275G>A | |||||||||
| HGVSg | CHROMOSOME_III:g.11376127C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y47D3B | |||||
| Flanking_sequences | ataaccccacaaatcttcagatctttgact | gaaggagatcgagtcgaaaatgaacgcaaa | |||||||
| Mapping_target | Y47D3B | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004203 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (196) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001077 | |||||||
| Transcript | Y47D3B.10.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y47D3B.10.1:c.275G>A | ||||||||
| HGVSp | CE20261:p.Trp92Ter | ||||||||
| cDNA_position | 276 | ||||||||
| CDS_position | 275 | ||||||||
| Protein_position | 92 | ||||||||
| Exon_number | 3/9 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000052376 | ||||||||
| WBInteraction000537326 | |||||||||
| WBInteraction000576800 | |||||||||
| Genetics | Interpolated_map_position | III | 8.86179 | ||||||
| Mapping_data | In_2_point (46) | ||||||||
| In_multi_point | 70 | ||||||||
| 81 | |||||||||
| 85 | |||||||||
| 89 | |||||||||
| 91 | |||||||||
| 92 | |||||||||
| 211 | |||||||||
| 212 | |||||||||
| 213 | |||||||||
| 214 | |||||||||
| 215 | |||||||||
| 216 | |||||||||
| 217 | |||||||||
| 221 | |||||||||
| 255 | |||||||||
| 300 | |||||||||
| 301 | |||||||||
| 316 | |||||||||
| 318 | |||||||||
| 369 | |||||||||
| 370 | |||||||||
| 375 | |||||||||
| 430 | |||||||||
| 469 | |||||||||
| 471 | |||||||||
| 472 | |||||||||
| 473 | |||||||||
| 474 | |||||||||
| 476 | |||||||||
| 482 | |||||||||
| 489 | |||||||||
| 493 | |||||||||
| 500 | |||||||||
| 503 | |||||||||
| 514 | |||||||||
| 561 | |||||||||
| 562 | |||||||||
| 599 | |||||||||
| 601 | |||||||||
| 1081 | |||||||||
| 1083 | |||||||||
| 1364 | |||||||||
| 1406 | |||||||||
| 1420 | |||||||||
| 1505 | |||||||||
| 1510 | |||||||||
| 1660 | |||||||||
| 1728 | |||||||||
| 1735 | |||||||||
| 1752 | |||||||||
| 1756 | |||||||||
| 1757 | |||||||||
| 1812 | |||||||||
| 1814 | |||||||||
| 1815 | |||||||||
| 1816 | |||||||||
| 1835 | |||||||||
| 2027 | |||||||||
| 2028 | |||||||||
| 2029 | |||||||||
| 2116 | |||||||||
| 2117 | |||||||||
| 2200 | |||||||||
| 2201 | |||||||||
| 2202 | |||||||||
| 2203 | |||||||||
| 2204 | |||||||||
| 2205 | |||||||||
| 2212 | |||||||||
| 2235 | |||||||||
| 2249 | |||||||||
| 2250 | |||||||||
| 2306 | |||||||||
| 2338 | |||||||||
| 3053 | |||||||||
| 3054 | |||||||||
| 3108 | |||||||||
| 3109 | |||||||||
| 3111 | |||||||||
| 3139 | |||||||||
| 3236 | |||||||||
| 3237 | |||||||||
| 3246 | |||||||||
| 3247 | |||||||||
| 3248 | |||||||||
| 3261 | |||||||||
| 3262 | |||||||||
| 3263 | |||||||||
| 3264 | |||||||||
| 3265 | |||||||||
| In_pos_neg_data | 1600 | ||||||||
| 2153 | |||||||||
| Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000199 | Paper_evidence | WBPaper00001328 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | The temperature sensitive period for the Ram defect was mid-to late L4 coincident with tail retraction. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000073 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Homozygous Ram. Males are not Ram at 16C. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Males have abnormal lumpy rays (Ram) at 25C. | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001328 | |||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
| WBPaper00001328 | |||||||||
| WBPaper00005747 | |||||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| WBPerson2987 | |||||||||
| Remark | Medium dumpy. Easy to score (ES3) in adult; difficult to score (ES2) in larvae. ME2. Males have abnormal lumpy rays (Ram) at 25C | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Authors report "medium dpy" (Table 1) | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "abnormal branched ala" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001678 | Paper_evidence | WBPaper00003994 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | There was a significant reduction in the hydroxyproline content of cuticle collagen from dpy-18 (e364) animals compared with wild-type cuticle extracts. | Paper_evidence | WBPaper00003994 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000695 | Paper_evidence | WBPaper00001328 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals have 77%(n=20) mutant seam cell nuclei, similar to XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Animals were raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001732 | Paper_evidence | WBPaper00032033 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals exhibited the same pH survival profile as the wild-type strain over a range of pH 3 to pH 10. | Paper_evidence | WBPaper00032033 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Treatment | Mixed or synchronised populations of nematodes were exposed to 500ul M9 buffer (100 mM phosphate, 85 mM NaCl, 1 mM MgSO4 buffered at the appropriate pH by varying KH2PO4 and Na2HPO4 concentrations accordingly) at varying pHs in a 24-well plate format for 4 h (200 nematodes/well). Nematodes were scored as viable by the presence of touch response and pharyngeal pumping. | Paper_evidence | WBPaper00032033 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (22) | |||||||||
| Method | Substitution_allele |
