WormBase Tree Display for Variation: WBVar00143148
expand all nodes | collapse all nodes | view schema
WBVar00143148 | Evidence | Person_evidence | WBPerson23830 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e362 | ||||||
Other_name | CE31847:p.Gln6622Ter | |||||||
B0350.2f.1:c.19864C>T | ||||||||
HGVSg | CHROMOSOME_IV:g.6002537C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | B0350 | ||||
Flanking_sequences | gtctacgatgctgatacggaagaacaaaat | aacagttagaagaactggaaactgttgaag | ||||||
Mapping_target | B0350 | |||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson23830 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004153 | |||||||
WBStrain00006357 | ||||||||
WBStrain00007116 | ||||||||
WBStrain00027196 | ||||||||
WBStrain00033499 | ||||||||
WBStrain00033522 | ||||||||
Laboratory | CB | |||||||
Person | WBPerson23830 | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006780 | ||||||
Transcript | B0350.2f.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0350.2f.1:c.19864C>T | |||||||
HGVSp | CE31847:p.Gln6622Ter | |||||||
cDNA_position | 19864 | |||||||
CDS_position | 19864 | |||||||
Protein_position | 6622 | |||||||
Exon_number | 16/20 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000556072 | |||||||
Genetics | Interpolated_map_position | IV | 2.88918 | |||||
Mapping_data | In_2_point | 110 | ||||||
825 | ||||||||
In_multi_point (29) | ||||||||
Description | Phenotype (10) | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants for unc-44 gene encoding a C. elegans homolog of ankyrin G (OTSUKA et al. 1995) showed normal localization ofSNB-1::VENUS in RIA. | Paper_evidence | WBPaper00040857 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00040857 | |||||||
WBPaper00028448 | ||||||||
WBPaper00032446 | ||||||||
WBPaper00000031 | ||||||||
WBPaper00006052 | ||||||||
WBPaper00022718 | ||||||||
WBPaper00003760 | ||||||||
WBPaper00016121 | ||||||||
WBPaper00045955 | ||||||||
WBPaper00049389 | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |