WormBase Tree Display for Variation: WBVar00143148
expand all nodes | collapse all nodes | view schema
WBVar00143148 | Evidence | Person_evidence | WBPerson23830 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e362 | |||||||
Other_name | CE31847:p.Gln6622Ter | ||||||||
B0350.2f.1:c.19864C>T | |||||||||
HGVSg | CHROMOSOME_IV:g.6002537C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0350 | |||||
Flanking_sequences | gtctacgatgctgatacggaagaacaaaat | aacagttagaagaactggaaactgttgaag | |||||||
Mapping_target | B0350 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson23830 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004153 | ||||||||
WBStrain00006357 | |||||||||
WBStrain00007116 | |||||||||
WBStrain00027196 | |||||||||
WBStrain00033499 | |||||||||
WBStrain00033522 | |||||||||
Laboratory | CB | ||||||||
Person | WBPerson23830 | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006780 | |||||||
Transcript | B0350.2f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0350.2f.1:c.19864C>T | ||||||||
HGVSp | CE31847:p.Gln6622Ter | ||||||||
cDNA_position | 19864 | ||||||||
CDS_position | 19864 | ||||||||
Protein_position | 6622 | ||||||||
Exon_number | 16/20 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000556072 | ||||||||
Genetics | Interpolated_map_position | IV | 2.88918 | ||||||
Mapping_data | In_2_point | 110 | |||||||
825 | |||||||||
In_multi_point | 121 | ||||||||
779 | |||||||||
1138 | |||||||||
1258 | |||||||||
1259 | |||||||||
1708 | |||||||||
1721 | |||||||||
1792 | |||||||||
1893 | |||||||||
1895 | |||||||||
2025 | |||||||||
2026 | |||||||||
2400 | |||||||||
2720 | |||||||||
2721 | |||||||||
2722 | |||||||||
2723 | |||||||||
2724 | |||||||||
2725 | |||||||||
2726 | |||||||||
2727 | |||||||||
2728 | |||||||||
2729 | |||||||||
2730 | |||||||||
2731 | |||||||||
3033 | |||||||||
3152 | |||||||||
3153 | |||||||||
3154 | |||||||||
Description | Phenotype | WBPhenotype:0000229 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | paralysed coiler | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00045955 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000880 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | amphid, phasmid, PVP, PDE and other axons abnormal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001329 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tends to curl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001661 | Paper_evidence | WBPaper00003760 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants are defective in str-2 asymmetry: str-2 was expressed in either 0, 1, or 2 AWC cells in unc-44 mutants | Paper_evidence | WBPaper00003760 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00003760 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002521 | Paper_evidence | WBPaper00049389 | |||||||
Curator_confirmed | WBPerson30255 | ||||||||
EQ_annotations | GO_term | GO:0005921 | PATO:0000470 | Paper_evidence | WBPaper00049389 | ||||
Curator_confirmed | WBPerson30255 | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak FITC uptake | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants for unc-44 gene encoding a C. elegans homolog of ankyrin G (OTSUKA et al. 1995) showed normal localization ofSNB-1::VENUS in RIA. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00028448 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | PKD-2::GFP localization is not different from wild type. | Paper_evidence | WBPaper00028448 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040857 | ||||||||
WBPaper00028448 | |||||||||
WBPaper00032446 | |||||||||
WBPaper00000031 | |||||||||
WBPaper00006052 | |||||||||
WBPaper00022718 | |||||||||
WBPaper00003760 | |||||||||
WBPaper00016121 | |||||||||
WBPaper00045955 | |||||||||
WBPaper00049389 | |||||||||
Remark | alt_det = c to t mut_det = Q(6621)Ochre | ||||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006780 Ochre_UAA | |||||||||
Method | Substitution_allele |