WormBase Tree Display for Variation: WBVar00143095
expand all nodes | collapse all nodes | view schema
WBVar00143095 | Evidence | Paper_evidence | WBPaper00030788 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e300 | |||||
Other_name | CE27791:p.Gln36Ter | ||||||
C04F5.3.1:c.106C>T | |||||||
HGVSg | CHROMOSOME_V:g.5098798G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | C04F5 | |||
Flanking_sequences | ggtatagaatcaagttttgttcatgaaaat | aaacaattggattgaaaaaggaaaatgttt | |||||
Mapping_target | C04F5 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030788 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006782 | |||||
Transcript | C04F5.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C04F5.3.1:c.106C>T | ||||||
HGVSp | CE27791:p.Gln36Ter | ||||||
cDNA_position | 228 | ||||||
CDS_position | 106 | ||||||
Protein_position | 36 | ||||||
Exon_number | 2/9 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | V | -2.5189 | ||||
Description | Phenotype | WBPhenotype:0000324 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | shorter than unc-43(e408) | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | shrinking more marked than unc-43(e408) | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00030788 | ||||||
Remark | Site of e300 lesion was estimated from figure 1; actual coordinates are not provided in the paper. | Paper_evidence | WBPaper00030788 | ||||
Method | Substitution_allele |