WormBase Tree Display for Variation: WBVar00143068
expand all nodes | collapse all nodes | view schema
WBVar00143068 | Name | Public_name | e257 | ||||
---|---|---|---|---|---|---|---|
Other_name (2) | |||||||
HGVSg | CHROMOSOME_V:g.14374936G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F56A12 | |||
Flanking_sequences | gcaaagaactgaatccagtggaaaaatatc | gctgagacgaaagtttccggctccgaaaac | |||||
Mapping_target | F56A12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050496 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004136 | ||||||
WBStrain00005888 | |||||||
WBStrain00006218 | |||||||
WBStrain00027367 | |||||||
WBStrain00033528 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006775 | |||||
Transcript | F56A12.1.1 (12) | ||||||
Genetics | Interpolated_map_position | V | 6.28204 | ||||
Mapping_data | In_2_point | 132 | |||||
839 | |||||||
1725 | |||||||
In_multi_point | 150 | ||||||
331 | |||||||
661 | |||||||
668 | |||||||
947 | |||||||
1175 | |||||||
1176 | |||||||
1178 | |||||||
3024 | |||||||
In_pos_neg_data | 297 | ||||||
2131 | |||||||
3132 | |||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | fairly severe kinker, e257/Df more severe phenotypes | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000093 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | 15% of hermaphrodites have third gonad arm arising from additional somatic gonad founder, "Z5". e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000230 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | often withered tail as a result of 80% CAN migration defect; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000232 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | often withered tail as a result of 80% CAN migration defect; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000583 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | slightly dumpy; e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000594 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | migrations other than CAN also variably defective. e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||
WBPhenotype:0001928 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | 15% of hermaphrodites have third gonad arm arising from additional somatic gonad founder, "Z5". e257/Df more severe phenotypes. | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed (3) | |||||||
Disease_info | Models_disease | DOID:14702 | |||||
Models_disease_in_annotation | WBDOannot00000238 | ||||||
Reference | WBPaper00032446 | ||||||
WBPaper00000031 | |||||||
WBPaper00004883 | |||||||
WBPaper00016590 | |||||||
WBPaper00015049 | |||||||
WBPaper00050496 | |||||||
Method | Substitution_allele |