WormBase Tree Display for Variation: WBVar00143044
expand all nodes | collapse all nodes | view schema
WBVar00143044 | Evidence | Paper_evidence | WBPaper00006063 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00005177 | |||||||||
Name | Public_name | e224 | |||||||
Other_name | F46E10.9.1:c.227G>A | ||||||||
F46E10.9.2:c.227G>A | |||||||||
CE20819:p.Gly76Glu | |||||||||
HGVSg | CHROMOSOME_V:g.6512793C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F46E10 | |||||
Flanking_sequences | actggtctgatgatcttggaatcaaggttg | agaagtcgatgttaccgtcaatccaggact | |||||||
Mapping_target | F46E10 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (130) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001073 | |||||||
Transcript | F46E10.9.2 (12) | ||||||||
F46E10.9.1 (12) | |||||||||
Interactor (14) | |||||||||
Genetics | Interpolated_map_position | V | -0.00724445 | ||||||
Mapping_data | In_2_point (85) | ||||||||
In_multi_point (181) | |||||||||
In_pos_neg_data (12) | |||||||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1; "The point-mutant dpy-11(e224) results in a partial-loss-of-function mutation, characterized by a medium Dpy phenotype and additional male tail-specific morphologic defects." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000199 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The temperature sensitive period for the Ram defect was mid-to late L4 coincident with tail retraction. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000073 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000424 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "TP12:kaIs(col-19::gfp) and CB224(dpy-11) nematodes were crossed to produce the strain TP16:dpy-11(e224)V;kaIs12(col-19::gfp) that exhibited irregular COL-19::GFP patterns similar but not identical to that of TP14:dpy-5(e61)I;kaIs12(col-19 ::gfp) in which annuli in the dorsal/ ventral hypodermally derived cuticle appeared as a regular, although slightly constricted pattern of bands, again consistent with the Dpy appearance (Fig. 3G,H, denoted an). Similar to dpy-5 mutants, in these dpy-11 mutant animals COL-19::GFP expression in the cuticle overlying the noncontracted seam cell cords was abnormal with annuli appearing branched, prematurely terminated, and occasionally absent, a pattern reflected in the fragmented and branched DPY-7 collagen pattern after antibody staining (Fig. 3H, doubleheaded arrow region)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Homozygous Ram. Males are not Ram at 16C. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Males Ram (lumpy rays) at 25C. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00001328 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00001474 | |||||||||
WBPaper00005747 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | medium dumpy, easy to score (ES3) in adult, difficult to score (ES2) in larvae. Males Ram (lumpy rays) at25C. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Authors report "medium dpy" (Table 1); "The point-mutant dpy-11(e224) results in a partial-loss-of-function mutation, characterized by a medium Dpy phenotype and additional male tail-specific morphologic defects... When examined at the SEM level, dpy-11(e224) nematodes were particularly Dpy at the mid-body and tail regions and the alae are bifurcated and branched (Fig. 3F, denoted by double-headed arrows)." | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "TP12:kaIs(col-19::gfp) and CB224(dpy-11) nematodes were crossed to produce the strain TP16:dpy-11(e224)V;kaIs12(col-19::gfp) that exhibited irregular COL-19::GFP patterns similar but not identical to that of TP14:dpy-5(e61)I;kaIs12(col-19 ::gfp) in which annuli in the dorsal/ ventral hypodermally derived cuticle appeared as a regular, although slightly constricted pattern of bands, again consistent with the Dpy appearance (Fig. 3G,H, denoted an). Similar to dpy-5 mutants, in these dpy-11 mutant animals COL-19::GFP expression in the cuticle overlying the noncontracted seam cell cords was abnormal with annuli appearing branched, prematurely terminated, and occasionally absent, a pattern reflected in the fragmented and branched DPY-7 collagen pattern after antibody staining (Fig. 3H, doubleheaded arrow region)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched ala" (Table 1); "When examined at the SEM level, dpy-11(e224) nematodes were particularly Dpy at the mid-body and tail regions and the alae are bifurcated and branched (Fig. 3F, denoted by double-headed arrows)... Lateral ala are present, as depicted with COL-19::GFP and Nomarski, but unlike dpy-5 mutants, in many regions the alae are abnormal, commonly having an unusual bifurcated (Fig. 3G, arrowed) or broken appearance (Fig. 3J, arrowed)." | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ray function was not severely disrupted by the morphological defects as most Ram males mated efficiently | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (19) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |