WormBase Tree Display for Variation: WBVar00143023
expand all nodes | collapse all nodes | view schema
WBVar00143023 | Evidence | Person_evidence | WBPerson499 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e189 | |||||||
Other_name | ZK637.8a.1:c.614+288G>A | ||||||||
ZK637.8e.1:c.460-345G>A | |||||||||
ZK637.8f.1:c.460-1G>A | |||||||||
ZK637.8c.1:c.460-345G>A | |||||||||
ZK637.8b.1:c.460-1G>A | |||||||||
ZK637.8d.1:c.614+288G>A | |||||||||
HGVSg | CHROMOSOME_III:g.8906966G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |||||
Flanking_sequences | taaaatctccttcactaacaca | gccgggactggagaaatgttgcca | |||||||
Mapping_target | ZK637 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (303) | |||||||||
Laboratory | CB | ||||||||
OJ | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006768 | |||||||
Transcript (6) | |||||||||
Interactor | WBInteraction000524785 | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | -0.00184685 | ||||||
Mapping_data | In_2_point (31) | ||||||||
In_multi_point (171) | |||||||||
In_pos_neg_data | 806 | ||||||||
3726 | |||||||||
Description | Phenotype | WBPhenotype:0000004 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weakly Egl-c | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000016 | Paper_evidence | WBPaper00037623 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00037623 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00037623 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00035198 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ric | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000020 | Paper_evidence | WBPaper00001709 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Slightly irregular pumping | Paper_evidence | WBPaper00001709 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00001709 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000164 | Paper_evidence | WBPaper00043908 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | rather thin | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | rather small | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severe coiler, little movement in adult; moves well in L1 but coils in response to touch in L2 and later stages | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000035 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001639 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001716 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002241 | Paper_evidence | WBPaper00064400 | |||||||
Curator_confirmed | WBPerson11689 | ||||||||
Remark | measured by the bacterial clearance assay | Paper_evidence | WBPaper00064400 | ||||||
Curator_confirmed | WBPerson11689 | ||||||||
WBPhenotype:0002284 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002288 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002291 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002295 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002300 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002301 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002308 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002312 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002323 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002335 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002344 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002345 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0004023 | Paper_evidence | WBPaper00043908 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (32) | |||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |