WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
| WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e188 | |||||||
| Other_name | e188ts | ||||||||
| H27M09.4.1:c.415G>C | |||||||||
| CE25036:p.Gly139Arg | |||||||||
| HGVSg | CHROMOSOME_I:g.6844486G>C | ||||||||
| Sequence_details | SMap | S_parent | Sequence | H27M09 | |||||
| Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | |||||||
| Mapping_target | H27M09 | ||||||||
| Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain (62) | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001075 | |||||||
| Transcript | H27M09.4.1 (12) | ||||||||
| Interactor | WBInteraction000518462 | ||||||||
| Genetics | Interpolated_map_position | I | 1.37773 | ||||||
| Mapping_data | In_2_point | 5 | |||||||
| 241 | |||||||||
| 242 | |||||||||
| 5116 | |||||||||
| 5118 | |||||||||
| 6055 | |||||||||
| In_multi_point | 12 | ||||||||
| 231 | |||||||||
| 236 | |||||||||
| 237 | |||||||||
| 241 | |||||||||
| 242 | |||||||||
| 243 | |||||||||
| 244 | |||||||||
| 248 | |||||||||
| 250 | |||||||||
| 251 | |||||||||
| 279 | |||||||||
| 283 | |||||||||
| 290 | |||||||||
| 345 | |||||||||
| 346 | |||||||||
| 431 | |||||||||
| 432 | |||||||||
| 433 | |||||||||
| 435 | |||||||||
| 438 | |||||||||
| 439 | |||||||||
| 443 | |||||||||
| 446 | |||||||||
| 447 | |||||||||
| 449 | |||||||||
| 450 | |||||||||
| 710 | |||||||||
| 814 | |||||||||
| 1223 | |||||||||
| 1232 | |||||||||
| 1235 | |||||||||
| 1274 | |||||||||
| 1460 | |||||||||
| 1461 | |||||||||
| 1462 | |||||||||
| 1463 | |||||||||
| 1464 | |||||||||
| 1465 | |||||||||
| 1466 | |||||||||
| 1694 | |||||||||
| 1784 | |||||||||
| 1889 | |||||||||
| 1890 | |||||||||
| 1892 | |||||||||
| 2000 | |||||||||
| 2089 | |||||||||
| 2140 | |||||||||
| 2141 | |||||||||
| 2142 | |||||||||
| 2143 | |||||||||
| 2144 | |||||||||
| 2145 | |||||||||
| 2146 | |||||||||
| 2147 | |||||||||
| 2148 | |||||||||
| 2149 | |||||||||
| 2150 | |||||||||
| 2281 | |||||||||
| 2282 | |||||||||
| 2459 | |||||||||
| 2468 | |||||||||
| 3004 | |||||||||
| 3005 | |||||||||
| 3196 | |||||||||
| 3513 | |||||||||
| In_pos_neg_data (55) | |||||||||
| Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | |||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ts lethal (25C). Lethality enhanced by Smg. ES3 (all stages 20C). | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson48 | ||||||||
| WBPerson712 | |||||||||
| Remark | Medium dumpy adult, strong dumpy L1 (20C). Easy to score (ES3) at all stages (20C). | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00001328 | ||||||||
| WBPaper00000031 | |||||||||
| WBPaper00004883 | |||||||||
| WBPaper00024024 | |||||||||
| WBPaper00014397 | |||||||||
| WBPaper00016102 | |||||||||
| WBPaper00025792 | |||||||||
| WBPaper00033444 | |||||||||
| WBPaper00061175 | |||||||||
| Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
| Method | Substitution_allele |
