WormBase Tree Display for Variation: WBVar00143011
expand all nodes | collapse all nodes | view schema
WBVar00143011 | Evidence | Paper_evidence | WBPaper00030788 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e177 | |||||
Other_name | CE27791:p.Trp124Ter | ||||||
C04F5.3.1:c.372G>A | |||||||
HGVSg | CHROMOSOME_V:g.5098362C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C04F5 | |||
Flanking_sequences | gcgtgcaaagcgccttgatgaattgagatg | caattgaacaaagtgatctacgaggaaaaa | |||||
Mapping_target | C04F5 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00030788 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (163) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006782 | |||||
Transcript | C04F5.3.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C04F5.3.1:c.372G>A | ||||||
HGVSp | CE27791:p.Trp124Ter | ||||||
cDNA_position | 494 | ||||||
CDS_position | 372 | ||||||
Protein_position | 124 | ||||||
Exon_number | 5/9 | ||||||
Codon_change | tgG/tgA | ||||||
Amino_acid_change | W/* | ||||||
Genetics | Interpolated_map_position | V | -2.51992 | ||||
Mapping_data | In_2_point | 126 | |||||
314 | |||||||
1765 | |||||||
1766 | |||||||
1767 | |||||||
1768 | |||||||
1769 | |||||||
1770 | |||||||
1771 | |||||||
1772 | |||||||
2843 | |||||||
2881 | |||||||
3075 | |||||||
3273 | |||||||
3438 | |||||||
3455 | |||||||
3456 | |||||||
3457 | |||||||
3458 | |||||||
3459 | |||||||
3571 | |||||||
3572 | |||||||
4443 | |||||||
4444 | |||||||
4445 | |||||||
4446 | |||||||
4447 | |||||||
In_multi_point (24) | |||||||
In_pos_neg_data | 845 | ||||||
2134 | |||||||
3076 | |||||||
3259 | |||||||
Description | Phenotype (5) | ||||||
Reference | WBPaper00029020 | ||||||
WBPaper00001474 | |||||||
WBPaper00000031 | |||||||
WBPaper00014148 | |||||||
WBPaper00022021 | |||||||
WBPaper00025822 | |||||||
Remark | Site of e177 lesion was estimated from figure 1; actual coordinates are not provided in the paper. | Paper_evidence | WBPaper00030788 | ||||
Method | Substitution_allele |