WormBase Tree Display for Variation: WBVar00143010
expand all nodes | collapse all nodes | view schema
| WBVar00143010 | Evidence | Paper_evidence | WBPaper00004275 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e176 | |||||
| Other_name | JC8.10a.1:c.2146G>A | ||||||
| CE29050:p.Asp722Asn | |||||||
| CE28239:p.Asp716Asn | |||||||
| JC8.10b.1:c.2164G>A | |||||||
| HGVSg | CHROMOSOME_IV:g.13265336C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | JC8 | |||
| Flanking_sequences | gactcgcatgacgtcatattttggttggga | atttcaactatcgaattaatttgtcggggg | |||||
| Mapping_target | JC8 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006763 | |||||
| Transcript | JC8.10b.1 (12) | ||||||
| JC8.10a.1 (12) | |||||||
| Genetics | Interpolated_map_position | IV | 8.5125 | ||||
| Description | Phenotype | WBPhenotype:0000017 | Paper_evidence | WBPaper00004275 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Strong allele. unc-26 mutants are strongly resistant to inhibitors of acetylcholinesterase, indicative of a decrease in acetylcholine release. | Paper_evidence | WBPaper00004275 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000210 | Paper_evidence | WBPaper00004275 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Strong allele. unc-26 mutants have reduced numbers of enteric muscle contractions, indicative of GABAergic function. | Paper_evidence | WBPaper00004275 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000229 | Paper_evidence | WBPaper00004275 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals are small. | Paper_evidence | WBPaper00004275 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000455 | Paper_evidence | WBPaper00004275 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; animals move backwards with a jerky motion. | Paper_evidence | WBPaper00004275 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000565 | Paper_evidence | WBPaper00004275 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Strong allele. unc-26 mutants resemble mutants lacking the biosynthetic enzyme for acetylcholine encoded by the cha-1 gene; frequently coil. | Paper_evidence | WBPaper00004275 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00004275 | ||||||
| WBPaper00013791 | |||||||
| Method | Substitution_allele |
