WormBase Tree Display for Variation: WBVar00142997
expand all nodes | collapse all nodes | view schema
WBVar00142997 | Evidence | Paper_evidence | WBPaper00005582 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e152 | |||||||
Other_name (13) | |||||||||
HGVSg | CHROMOSOME_IV:g.5498135G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0273 | |||||
Flanking_sequences | ttagacacttcacaaaatattgttgctgcg | agattgatagcaatggagcacgattgtctt | |||||||
Mapping_target | B0273 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000490 | ||||||||
WBStrain00000502 | |||||||||
WBStrain00000503 | |||||||||
WBStrain00000504 | |||||||||
WBStrain00000657 | |||||||||
WBStrain00004112 | |||||||||
WBStrain00028683 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006745 | |||||||
Transcript | B0273.4f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4f.1:c.733C>T | ||||||||
HGVSp | CE49300:p.Gln245Ter | ||||||||
cDNA_position | 733 | ||||||||
CDS_position | 733 | ||||||||
Protein_position | 245 | ||||||||
Exon_number | 2/4 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4e.1:c.1018C>T | ||||||||
HGVSp | CE49455:p.Gln340Ter | ||||||||
cDNA_position | 1018 | ||||||||
CDS_position | 1018 | ||||||||
Protein_position | 340 | ||||||||
Exon_number | 3/5 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4c.1:c.1603C>T | ||||||||
HGVSp | CE16791:p.Gln535Ter | ||||||||
cDNA_position | 1603 | ||||||||
CDS_position | 1603 | ||||||||
Protein_position | 535 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4a.1:c.1519C>T | ||||||||
HGVSp | CE16790:p.Gln507Ter | ||||||||
cDNA_position | 1521 | ||||||||
CDS_position | 1519 | ||||||||
Protein_position | 507 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4d.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.2:c.1195C>T | ||||||||
HGVSp | CE49241:p.Gln399Ter | ||||||||
cDNA_position | 1199 | ||||||||
CDS_position | 1195 | ||||||||
Protein_position | 399 | ||||||||
Exon_number | 5/8 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4b.1:c.1519C>T | ||||||||
HGVSp | CE37693:p.Gln507Ter | ||||||||
cDNA_position | 1519 | ||||||||
CDS_position | 1519 | ||||||||
Protein_position | 507 | ||||||||
Exon_number | 6/6 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
B0273.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.1:c.1195C>T | ||||||||
HGVSp | CE49241:p.Gln399Ter | ||||||||
cDNA_position | 1398 | ||||||||
CDS_position | 1195 | ||||||||
Protein_position | 399 | ||||||||
Exon_number | 6/9 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (27) | |||||||||
Genetics | Interpolated_map_position | IV | 1.75578 | ||||||
Mapping_data | In_2_point | 119 | |||||||
408 | |||||||||
477 | |||||||||
4236 | |||||||||
In_multi_point (25) | |||||||||
Description | Phenotype | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The hypomorphic mutation unc-5(e152) causes defects in 12% of anterior and 46% of posterior DTCs (n = 578; Table 1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants displayed a nearly complete failure of dorsally directed VD axons to reach the dorsal cord. | Paper_evidence | WBPaper00040147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000539 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dorsal cord partially formed | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker phenotype than e53, behaviorally and anatomically, dorsal cord partially formed | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001984 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a high level of long-range axon migration defects | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001985 | Paper_evidence | WBPaper00038105 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited a low level of short-range axon migration defects. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000233 | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants have within WT levels of Dopamine and Dopa. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit any defects in ventrally-directed HSN axon guidance. | Paper_evidence | WBPaper00040147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001518 | Paper_evidence | WBPaper00000365 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Formaldehyde induced fluorescence is (FIF) is normal. | Paper_evidence | WBPaper00000365 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038105 | ||||||||
WBPaper00040147 | |||||||||
WBPaper00025979 | |||||||||
WBPaper00005809 | |||||||||
WBPaper00016140 | |||||||||
WBPaper00000365 | |||||||||
WBPaper00026419 | |||||||||
Method | Substitution_allele |