WormBase Tree Display for Variation: WBVar00142989
expand all nodes | collapse all nodes | view schema
WBVar00142989 | Evidence | Person_evidence | WBPerson11112 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e138 | |||||
Other_name | e138am | ||||||
F57H12.2.1:c.445C>T | |||||||
CE52881:p.Gln149Ter | |||||||
HGVSg | CHROMOSOME_IV:g.7980970C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F57H12 | |||
Flanking_sequences | aaattggtagttttacgcctgggaagagct | agaagacaagaggacctggtataactttag | |||||
Mapping_target | F57H12 | ||||||
Type_of_mutation | Substitution | c | t | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (89) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006761 | |||||
Transcript | F57H12.2.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F57H12.2.1:c.445C>T | ||||||
HGVSp | CE52881:p.Gln149Ter | ||||||
cDNA_position | 458 | ||||||
CDS_position | 445 | ||||||
Protein_position | 149 | ||||||
Exon_number | 5/8 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000500601 | ||||||
WBInteraction000519108 | |||||||
WBInteraction000519121 | |||||||
WBInteraction000524784 | |||||||
WBInteraction000556982 | |||||||
WBInteraction000556983 | |||||||
WBInteraction000556984 | |||||||
WBInteraction000556985 | |||||||
Genetics (2) | |||||||
Description | Phenotype | WBPhenotype:0000002 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | weak kinker, severe kinker in L1 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000353 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | tends to back | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000551 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | often forms omega shape | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||
Phenotype_not_observed | WBPhenotype:0000032 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | fairly active; healthy | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00040284 | ||||||
WBPaper00014528 | |||||||
WBPaper00000031 | |||||||
WBPaper00013927 | |||||||
WBPaper00013987 | |||||||
WBPaper00015247 | |||||||
WBPaper00013817 | |||||||
WBPaper00013879 | |||||||
WBPaper00061173 | |||||||
WBPaper00065317 | |||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Method | Substitution_allele |