WormBase Tree Display for Variation: WBVar00142948
expand all nodes | collapse all nodes | view schema
| WBVar00142948 | Evidence | Paper_evidence | WBPaper00001431 | ||
|---|---|---|---|---|---|
| Person_evidence | WBPerson267 | ||||
| Name | Public_name | e73 | |||
| Other_name | CE09197:p.Glu342Lys | ||||
| F07A5.7a.2:c.1024G>A | |||||
| F07A5.7b.1:c.67G>A | |||||
| F07A5.7a.1:c.1024G>A | |||||
| CE42754:p.Glu23Lys | |||||
| HGVSg | CHROMOSOME_I:g.7379262C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | F07A5 | |
| Flanking_sequences | gagatcatgctccagaagatttctcaactc | agaaggccaagtctcgtcttcaatctgagg | |||
| Mapping_target | F07A5 | ||||
| Type_of_mutation | Substitution | G | A | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (35) | |||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00006754 | |||
| Transcript | F07A5.7a.1 (12) | ||||
| F07A5.7a.2 (12) | |||||
| F07A5.7b.1 (12) | |||||
| Interactor | WBInteraction000518394 | ||||
| WBInteraction000518614 | |||||
| WBInteraction000518905 | |||||
| Isolation | Mutagen | EMS | |||
| Forward_genetics | standard phenotypic screen | ||||
| Genetics | Interpolated_map_position | I | 2.05567 | ||
| Mapping_data | In_2_point | 13 | |||
| 238 | |||||
| 516 | |||||
| 1017 | |||||
| In_multi_point (14) | |||||
| In_pos_neg_data | 515 | ||||
| 2518 | |||||
| 4992 | |||||
| 4999 | |||||
| 5003 | |||||
| 5345 | |||||
| Description | Phenotype (10) | ||||
| Reference (31) | |||||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 342 E to K | ||||
| Method | Substitution_allele |
