WormBase Tree Display for Variation: WBVar00142948
expand all nodes | collapse all nodes | view schema
WBVar00142948 | Evidence | Paper_evidence | WBPaper00001431 | ||||||
---|---|---|---|---|---|---|---|---|---|
Person_evidence | WBPerson267 | ||||||||
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | |||||
Flanking_sequences | gagatcatgctccagaagatttctcaactc | agaaggccaagtctcgtcttcaatctgagg | |||||||
Mapping_target | F07A5 | ||||||||
Type_of_mutation | Substitution | G | A | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (35) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006754 | |||||||
Transcript | F07A5.7a.1 (12) | ||||||||
F07A5.7a.2 (12) | |||||||||
F07A5.7b.1 (12) | |||||||||
Interactor | WBInteraction000518394 | ||||||||
WBInteraction000518614 | |||||||||
WBInteraction000518905 | |||||||||
Isolation | Mutagen | EMS | |||||||
Forward_genetics | standard phenotypic screen | ||||||||
Genetics | Interpolated_map_position | I | 2.05567 | ||||||
Mapping_data | In_2_point | 13 | |||||||
238 | |||||||||
516 | |||||||||
1017 | |||||||||
In_multi_point (14) | |||||||||
In_pos_neg_data (6) | |||||||||
Description | Phenotype | WBPhenotype:0000349 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | limp paralysed phenotype | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000509 | Paper_evidence | WBPaper00000536 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only 3.1% of the sperm have pseudopods, a few of which are smooth. | Paper_evidence | WBPaper00000536 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006798 | PATO:0000460 | Paper_evidence | WBPaper00000536 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Egl | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | limp paralysed phenotype, larvae move slightly better | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | e73/+ slightly slow | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000782 | Paper_evidence | WBPaper00027179 | |||||||
Curator_confirmed | WBPerson5 | ||||||||
WBPhenotype:0000861 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000926 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
disorganized muscle structure | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001292 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | defect in body muscle cells | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00027179 | |||||||
Curator_confirmed | WBPerson5 | ||||||||
Reference (31) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 342 E to K | ||||||||
Method | Substitution_allele |