WormBase Tree Display for Variation: WBVar00142947
expand all nodes | collapse all nodes | view schema
| WBVar00142947 | Evidence | Paper_evidence | WBPaper00030754 | ||||
|---|---|---|---|---|---|---|---|
| Name (3) | |||||||
| Sequence_details | SMap | S_parent | Sequence | ZK897 | |||
| Flanking_sequences | gatgacgaaaatgagcgacatctatgggtc | aggctctgtaccgagccacaggtcaagcct | |||||
| Mapping_target | ZK897 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030754 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006767 | |||||
| Transcript (17) | |||||||
| Genetics | Interpolated_map_position | IV | 6.32069 | ||||
| Description | Phenotype | WBPhenotype:0000644 | Paper_evidence | WBPaper00030754 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Contains the same amber suppressible mutation as e375 and u280 | Paper_evidence | WBPaper00030754 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00030754 | ||||||
| Method | Substitution_allele |
