WormBase Tree Display for Variation: WBVar00142938
expand all nodes | collapse all nodes | view schema
WBVar00142938 | Evidence | Paper_evidence | WBPaper00006005 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e55 | |||||
Other_name (30) | |||||||
HGVSg | CHROMOSOME_X:g.2723343G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T02C5 | |||
Flanking_sequences | agacggcgagccgctaataaaaagttaaaa | aagcctcaaaacagcagtctacagaaactg | |||||
Mapping_target | T02C5 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006005 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (14) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006742 | |||||
Transcript (15) | |||||||
Interactor (5) | |||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | X | -13.8024 | ||||
Mapping_data | In_2_point | 154 | |||||
3151 | |||||||
In_multi_point (14) | |||||||
In_pos_neg_data (18) | |||||||
Description | Phenotype (16) | ||||||
Phenotype_not_observed (4) | |||||||
Reference (21) | |||||||
Remark | Resequencing of e55 places the lesion at Q(458) (in isoform T02C5.5b) with flanks of agacggcgagccgctaataaaaagttaaaa & aagcctcaaaacagcagtctacagaaactg | Person_evidence | WBPerson12335 | ||||
Laboratory_evidence | KG | ||||||
Following genotyping from the CGC we are updating the flanking sequences to follow both the reported update from 2011 and those now supplied by the CGC. Old flanks [tgttgccattcagttggaaaattcatcaaa aactgaggtaagaataaataatagtgtttt]. | Person_evidence | WBPerson2207 | |||||
Curator_confirmed | WBPerson1983 | ||||||
Method | Substitution_allele |