WormBase Tree Display for Variation: WBVar00142936
expand all nodes | collapse all nodes | view schema
| WBVar00142936 | Evidence | Paper_evidence | WBPaper00005582 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e53 | |||||||
| Other_name (13) | |||||||||
| HGVSg | CHROMOSOME_IV:g.5499260C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | B0273 | |||||
| Flanking_sequences | ttgatggaggatggagttcatggagtgatt | gagtgcttgctcttcgagttgtcatcggta | |||||||
| Mapping_target | B0273 | ||||||||
| Type_of_mutation | Substitution | g | a | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004233 | ||||||||
| WBStrain00004501 | |||||||||
| WBStrain00004562 | |||||||||
| WBStrain00004583 | |||||||||
| WBStrain00004944 | |||||||||
| WBStrain00004946 | |||||||||
| WBStrain00004964 | |||||||||
| WBStrain00004970 | |||||||||
| WBStrain00004993 | |||||||||
| WBStrain00005001 | |||||||||
| WBStrain00006207 | |||||||||
| WBStrain00006208 | |||||||||
| WBStrain00006288 | |||||||||
| WBStrain00006296 | |||||||||
| WBStrain00006297 | |||||||||
| WBStrain00006298 | |||||||||
| WBStrain00006299 | |||||||||
| WBStrain00006300 | |||||||||
| WBStrain00006303 | |||||||||
| WBStrain00006304 | |||||||||
| WBStrain00006305 | |||||||||
| WBStrain00006306 | |||||||||
| WBStrain00006307 | |||||||||
| WBStrain00006308 | |||||||||
| WBStrain00006309 | |||||||||
| WBStrain00006310 | |||||||||
| WBStrain00006317 | |||||||||
| WBStrain00007255 | |||||||||
| WBStrain00022026 | |||||||||
| WBStrain00022039 | |||||||||
| WBStrain00022044 | |||||||||
| WBStrain00022515 | |||||||||
| WBStrain00022609 | |||||||||
| WBStrain00026734 | |||||||||
| WBStrain00026769 | |||||||||
| WBStrain00027012 | |||||||||
| WBStrain00027101 | |||||||||
| WBStrain00027161 | |||||||||
| WBStrain00027195 | |||||||||
| WBStrain00027196 | |||||||||
| WBStrain00027197 | |||||||||
| WBStrain00033485 | |||||||||
| WBStrain00033529 | |||||||||
| WBStrain00034349 | |||||||||
| WBStrain00034706 | |||||||||
| WBStrain00035709 | |||||||||
| WBStrain00040435 | |||||||||
| WBStrain00040573 | |||||||||
| WBStrain00047007 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006745 | |||||||
| Transcript | B0273.4f.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4f.1:c.62G>A | ||||||||
| HGVSp | CE49300:p.Trp21Ter | ||||||||
| cDNA_position | 62 | ||||||||
| CDS_position | 62 | ||||||||
| Protein_position | 21 | ||||||||
| Exon_number | 1/4 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4e.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4e.1:c.347G>A | ||||||||
| HGVSp | CE49455:p.Trp116Ter | ||||||||
| cDNA_position | 347 | ||||||||
| CDS_position | 347 | ||||||||
| Protein_position | 116 | ||||||||
| Exon_number | 2/5 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4c.1:c.932G>A | ||||||||
| HGVSp | CE16791:p.Trp311Ter | ||||||||
| cDNA_position | 932 | ||||||||
| CDS_position | 932 | ||||||||
| Protein_position | 311 | ||||||||
| Exon_number | 6/10 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4a.1:c.848G>A | ||||||||
| HGVSp | CE16790:p.Trp283Ter | ||||||||
| cDNA_position | 850 | ||||||||
| CDS_position | 848 | ||||||||
| Protein_position | 283 | ||||||||
| Exon_number | 6/10 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4d.2 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4d.2:c.524G>A | ||||||||
| HGVSp | CE49241:p.Trp175Ter | ||||||||
| cDNA_position | 528 | ||||||||
| CDS_position | 524 | ||||||||
| Protein_position | 175 | ||||||||
| Exon_number | 4/8 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4b.1:c.848G>A | ||||||||
| HGVSp | CE37693:p.Trp283Ter | ||||||||
| cDNA_position | 848 | ||||||||
| CDS_position | 848 | ||||||||
| Protein_position | 283 | ||||||||
| Exon_number | 5/6 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| B0273.4d.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0273.4d.1:c.524G>A | ||||||||
| HGVSp | CE49241:p.Trp175Ter | ||||||||
| cDNA_position | 727 | ||||||||
| CDS_position | 524 | ||||||||
| Protein_position | 175 | ||||||||
| Exon_number | 5/9 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor (26) | |||||||||
| Genetics | Interpolated_map_position | IV | 1.757 | ||||||
| Mapping_data | In_2_point | 93 | |||||||
| 104 | |||||||||
| 118 | |||||||||
| 820 | |||||||||
| 1649 | |||||||||
| 3270 | |||||||||
| 3378 | |||||||||
| 3729 | |||||||||
| 6088 | |||||||||
| 7050 | |||||||||
| In_multi_point (47) | |||||||||
| In_pos_neg_data | 3700 | ||||||||
| Description | Phenotype (20) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | grows well | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||||
| WBPaper00040147 | |||||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | The primary axon of ADL grows into the nerve ring ventrally rather than laterally. This phenotype occurs at a lower frequency than the axon branching phenotype. AVM axons fail to grow ventrally. HSN motor neurons fail to polarize properly. | Paper_evidence | WBPaper00036484 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Animals do not exhibit any defects in ventrally-directed HSN axon guidance. | Paper_evidence | WBPaper00040147 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "We found that unc-5 mutants also had almost normal Q cell migrations (Fig. 2); thus UNC-5 does not appear to be a part of the UNC-40-dependent Q guidance system." | Paper_evidence | WBPaper00004437 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Null | Paper_evidence | WBPaper00035198 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000633 | Paper_evidence | WBPaper00036484 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | ADL projects normal dorsal and ventral branches. | Paper_evidence | WBPaper00036484 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Ventral muscle arm extension in animals was indistinguishable from that of wild-type controls. | Paper_evidence | WBPaper00032907 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (38) | |||||||||
| Method | Substitution_allele |
