WormBase Tree Display for Variation: WBVar00142936
expand all nodes | collapse all nodes | view schema
WBVar00142936 | Evidence | Paper_evidence | WBPaper00005582 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e53 | |||||||
Other_name (13) | |||||||||
HGVSg | CHROMOSOME_IV:g.5499260C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0273 | |||||
Flanking_sequences | ttgatggaggatggagttcatggagtgatt | gagtgcttgctcttcgagttgtcatcggta | |||||||
Mapping_target | B0273 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (49) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006745 | |||||||
Transcript | B0273.4f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4f.1:c.62G>A | ||||||||
HGVSp | CE49300:p.Trp21Ter | ||||||||
cDNA_position | 62 | ||||||||
CDS_position | 62 | ||||||||
Protein_position | 21 | ||||||||
Exon_number | 1/4 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4e.1:c.347G>A | ||||||||
HGVSp | CE49455:p.Trp116Ter | ||||||||
cDNA_position | 347 | ||||||||
CDS_position | 347 | ||||||||
Protein_position | 116 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4c.1:c.932G>A | ||||||||
HGVSp | CE16791:p.Trp311Ter | ||||||||
cDNA_position | 932 | ||||||||
CDS_position | 932 | ||||||||
Protein_position | 311 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4a.1:c.848G>A | ||||||||
HGVSp | CE16790:p.Trp283Ter | ||||||||
cDNA_position | 850 | ||||||||
CDS_position | 848 | ||||||||
Protein_position | 283 | ||||||||
Exon_number | 6/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4d.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.2:c.524G>A | ||||||||
HGVSp | CE49241:p.Trp175Ter | ||||||||
cDNA_position | 528 | ||||||||
CDS_position | 524 | ||||||||
Protein_position | 175 | ||||||||
Exon_number | 4/8 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4b.1:c.848G>A | ||||||||
HGVSp | CE37693:p.Trp283Ter | ||||||||
cDNA_position | 848 | ||||||||
CDS_position | 848 | ||||||||
Protein_position | 283 | ||||||||
Exon_number | 5/6 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
B0273.4d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0273.4d.1:c.524G>A | ||||||||
HGVSp | CE49241:p.Trp175Ter | ||||||||
cDNA_position | 727 | ||||||||
CDS_position | 524 | ||||||||
Protein_position | 175 | ||||||||
Exon_number | 5/9 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor (26) | |||||||||
Genetics | Interpolated_map_position | IV | 1.757 | ||||||
Mapping_data | In_2_point | 93 | |||||||
104 | |||||||||
118 | |||||||||
820 | |||||||||
1649 | |||||||||
3270 | |||||||||
3378 | |||||||||
3729 | |||||||||
6088 | |||||||||
7050 | |||||||||
In_multi_point (47) | |||||||||
In_pos_neg_data | 3700 | ||||||||
Description | Phenotype | WBPhenotype:0000004 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutation in the unc-5 gene results in premature termination of both the dorsal and sub-ventral process of the NSM neurons: 26% of the dorsal processes are short and 13% are absent | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000188 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | abnormal gonad arms | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00032163 | |||||||
WBPaper00040147 | |||||||||
WBPaper00031828 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Half of animals exhibited DA9 axon guidance defects. Axon guidance defects in VD and DD neurons were not enhnaced by expression of UNC-5 at the L4 larval stage. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutants displayed a nearly complete failure of dorsally directed VD axons to reach the dorsal cord. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit dorsal guidance defects. | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
DD and VD axon guidance defects were not suppressed by acetylcholine. | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
WBPaper00040147 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | 25 | Paper_evidence | WBPaper00032163 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-5::intron::unc-5 | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000516 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | distribution of cell bodies in ventral cord is disorganized | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000539 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dorsal nerve cord absent or almost absent | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006750 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000540 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | muscle arms misdirected | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000541 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | cord commissures fail to reach targets | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000565 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | severe coiler, L1 also severe coiler | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00040147 | |||||||
WBPaper00045955 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Branch defects scored in PLM neuron. | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00045955 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
WBPaper00001019 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Variation_effect | Null | Paper_evidence | WBPaper00000031 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The average number of GFP::RAB-3 puncta in the DA9 axon was reduced. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000802 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | dorsal hypodermal cells abnormal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007846 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Presynaptic components, such as RAB-3, SNB-1/synaptobrevin and SNG-1/synaptogyrin, the L-type voltage gated calcium channel b-subunit CCB-1, and the active zone protein SYD-2/a-liprin were mislocalized to the dendrite. Mislocalization defects in L1 and adult animals were rescued by a mig-5::unc-5 transgene and not unc-25::unc-5 or unc-129::unc-5 transgenes. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000880 | Paper_evidence | WBPaper00056066 | |||||||
Curator_confirmed | WBPerson18979 | ||||||||
Remark | ALA axon mispositioned | Paper_evidence | WBPaper00056066 | ||||||
Curator_confirmed | WBPerson18979 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003955 | PATO:0000460 | Paper_evidence | WBPaper00056066 | ||||
Curator_confirmed | WBPerson18979 | ||||||||
GO_term | GO:0030424 | PATO:0000628 | Paper_evidence | WBPaper00056066 | |||||
Curator_confirmed | WBPerson18979 | ||||||||
WBPhenotype:0000882 | Paper_evidence | WBPaper00032163 | |||||||
WBPaper00056066 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson18979 | |||||||||
Remark | The localization of four dendritically localized proteins (CAM-1/ROR16, UNC-9/innexin, F35D2.3/fibrillin and DYS-1/dystrophin16) were unaffected. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
PVD 1° dendrite branch mispositioned | Paper_evidence | WBPaper00056066 | |||||||
Curator_confirmed | WBPerson18979 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00032163 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00056066 | ||||||
Curator_confirmed | WBPerson18979 | ||||||||
GO_term | GO:0044307 | PATO:0000628 | Paper_evidence | WBPaper00056066 | |||||
Curator_confirmed | WBPerson18979 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00038105 | |||||||
WBPaper00003665 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | DA and DB axons are misrouted and fail to fully migrate to the dorsal cord. In some animals, axons fail to exit the ventral cord. | Paper_evidence | WBPaper00038105 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
99% of animals showed wild-type ASI amphid neuron outgrowth. Mutants also showed lateral axon outgrowth (1%). | Paper_evidence | WBPaper00003665 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | 1% | Paper_evidence | WBPaper00003665 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00003665 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs128[str-3::GFP] | Paper_evidence | WBPaper00003665 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00032163 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Presynaptic components such as RAB-3, calcium channel subunits and other active zone proteins are not excluded from DA9 dendrites as they are in control animals. | Paper_evidence | WBPaper00032163 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001931 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 4-6 muscle arms per side that project into the lateral space as they extended towards misguided commissural motor axons. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | grows well | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||||
WBPaper00040147 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The primary axon of ADL grows into the nerve ring ventrally rather than laterally. This phenotype occurs at a lower frequency than the axon branching phenotype. AVM axons fail to grow ventrally. HSN motor neurons fail to polarize properly. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals do not exhibit any defects in ventrally-directed HSN axon guidance. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that unc-5 mutants also had almost normal Q cell migrations (Fig. 2); thus UNC-5 does not appear to be a part of the UNC-40-dependent Q guidance system." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals do not exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ADL projects normal dorsal and ventral branches. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ventral muscle arm extension in animals was indistinguishable from that of wild-type controls. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (38) | |||||||||
Method | Substitution_allele |