WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name | Public_name | e51 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (18) | ||||||||
HGVSg | CHROMOSOME_I:g.7434408C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | ||||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | ||||||
Mapping_target | C44E1 | |||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Engineered_allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (64) | ||||||||
Laboratory | CB | |||||||
KR | ||||||||
NCA | ||||||||
Person | WBPerson26471 | |||||||
Status | Live | |||||||
Linked_to | WBVar02146566 | |||||||
Affects | Gene | WBGene00006752 | ||||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2e.1:c.1411C>T | |||||||
HGVSp | CE34626:p.Arg471Ter | |||||||
cDNA_position | 1411 | |||||||
CDS_position | 1411 | |||||||
Protein_position | 471 | |||||||
Exon_number | 11/30 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2c.1:c.388C>T | |||||||
HGVSp | CE34624:p.Arg130Ter | |||||||
cDNA_position | 388 | |||||||
CDS_position | 388 | |||||||
Protein_position | 130 | |||||||
Exon_number | 3/22 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2f.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2f.1:c.1420C>T | |||||||
HGVSp | CE43866:p.Arg474Ter | |||||||
cDNA_position | 1420 | |||||||
CDS_position | 1420 | |||||||
Protein_position | 474 | |||||||
Exon_number | 11/30 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2j.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2j.1:c.1375C>T | |||||||
HGVSp | CE51718:p.Arg459Ter | |||||||
cDNA_position | 1375 | |||||||
CDS_position | 1375 | |||||||
Protein_position | 459 | |||||||
Exon_number | 11/29 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2k.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2k.1:c.1366C>T | |||||||
HGVSp | CE51726:p.Arg456Ter | |||||||
cDNA_position | 1366 | |||||||
CDS_position | 1366 | |||||||
Protein_position | 456 | |||||||
Exon_number | 11/29 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2a.1:c.1411C>T | |||||||
HGVSp | CE15371:p.Arg471Ter | |||||||
cDNA_position | 1411 | |||||||
CDS_position | 1411 | |||||||
Protein_position | 471 | |||||||
Exon_number | 11/30 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2i.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2i.1:c.1420C>T | |||||||
HGVSp | CE32552:p.Arg474Ter | |||||||
cDNA_position | 1420 | |||||||
CDS_position | 1420 | |||||||
Protein_position | 474 | |||||||
Exon_number | 11/29 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2d.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2d.1:c.1411C>T | |||||||
HGVSp | CE34625:p.Arg471Ter | |||||||
cDNA_position | 1411 | |||||||
CDS_position | 1411 | |||||||
Protein_position | 471 | |||||||
Exon_number | 11/31 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
ZK524.2h.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK524.2h.1:c.388C>T | |||||||
HGVSp | CE51759:p.Arg130Ter | |||||||
cDNA_position | 388 | |||||||
CDS_position | 388 | |||||||
Protein_position | 130 | |||||||
Exon_number | 3/21 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor | WBInteraction000518950 | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | 2.07389 | |||||
Mapping_data (3) | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | able to lay eggs | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | ||||||
WBPaper00004883 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | as measured by fluorescence levels of ANF::GFP in coelomocytes | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG3683 unc-13(e51) oxIs206[Paex-3:ANF::GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
arIs37 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00031992 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. | Paper_evidence | WBPaper00031992 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (29) | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |