WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name | Public_name | e51 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (18) | ||||||||
HGVSg | CHROMOSOME_I:g.7434408C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | ||||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | ||||||
Mapping_target | C44E1 | |||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Engineered_allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (64) | ||||||||
Laboratory | CB | |||||||
KR | ||||||||
NCA | ||||||||
Person | WBPerson26471 | |||||||
Status | Live | |||||||
Linked_to | WBVar02146566 | |||||||
Affects (3) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | 2.07389 | |||||
Mapping_data | In_2_point (20) | |||||||
In_multi_point (87) | ||||||||
In_pos_neg_data | 466 | |||||||
470 | ||||||||
2514 | ||||||||
5851 | ||||||||
5853 | ||||||||
5963 | ||||||||
8066 | ||||||||
8086 | ||||||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | able to lay eggs | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | ||||||
WBPaper00004883 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | as measured by fluorescence levels of ANF::GFP in coelomocytes | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG3683 unc-13(e51) oxIs206[Paex-3:ANF::GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
arIs37 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001512 | Paper_evidence | WBPaper00031992 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ON-OFF asymmetry of ASEL and ASER was preserved in each of these animals. | Paper_evidence | WBPaper00031992 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (29) | ||||||||
Remark | Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1. | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP | Person_evidence (2) | |||||||
Method | Substitution_allele |