WormBase Tree Display for Variation: WBVar00142908
expand all nodes | collapse all nodes | view schema
WBVar00142908 | Evidence | Paper_evidence | WBPaper00006395 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e12 | |||||||
Other_name | CE35021:p.Gly149Glu | ||||||||
T21D12.2b.1:c.446G>A | |||||||||
T21D12.2a.1:c.446G>A | |||||||||
CE49091:p.Gly149Glu | |||||||||
HGVSg | CHROMOSOME_IV:g.258714C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T21D12 | |||||
Flanking_sequences | aatgtccaactggagctccaggaccaccag | acttccaggtaaatttgaattgcatcagga | |||||||
Mapping_target | T21D12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006395 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001071 | |||||||
Transcript | T21D12.2b.1 (12) | ||||||||
T21D12.2a.1 (12) | |||||||||
Interactor | WBInteraction000503698 | ||||||||
WBInteraction000537309 | |||||||||
Genetics | Interpolated_map_position | IV | -26.772 | ||||||
Mapping_data (3) | |||||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Life span of animals were not greater than that of wild type worms in the absence of infection. | Paper_evidence | WBPaper00032031 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Pnlp-29::GFP | Paper_evidence | WBPaper00032031 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Disease_info | Models_disease | DOID:37 | |||||||
Models_disease_in_annotation | WBDOannot00001177 | ||||||||
Reference (14) | |||||||||
Method | Substitution_allele |