WormBase Tree Display for Variation: WBVar00142901
expand all nodes | collapse all nodes | view schema
WBVar00142901 | Evidence | Paper_evidence | WBPaper00003865 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2 | |||||||
Other_name | CE25060:p.Gly912Glu | ||||||||
M03A1.1.1:c.2735G>A | |||||||||
HGVSg | CHROMOSOME_II:g.4589893G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | M03A1 | |||||
Flanking_sequences | tcactccatcctctgatgtctggtcgttcg | agttgtgatctgggaagtgtgttcattcgg | |||||||
Mapping_target | M03A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003865 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006868 | |||||||
Transcript | M03A1.1.1 (12) | ||||||||
Interactor (26) | |||||||||
Genetics | Interpolated_map_position | II | -3.84859 | ||||||
Mapping_data | In_multi_point | 881 | |||||||
882 | |||||||||
1880 | |||||||||
In_pos_neg_data | 4252 | ||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00040551 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "George et al. [8] previously found that P cell midline alignment and embryonic lethal defects are relatively rare in the kinase dead [vab-1(e2)] mutant embryos compared to vab-1(0) embryos (see also Figures 5A and 5C; Table S2), suggesting that a kinase-independent function of VAB-1 is largely sufficient for these processes." | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 6 | Paper_evidence | WBPaper00040551 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00040551 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000071 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000119 | Paper_evidence | WBPaper00035407 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | vab-1(e2) allele showed increased DAF-18/PTEN expression compared to wild-type levels | Paper_evidence | WBPaper00035407 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Western blots with DAF-18 antibody | Paper_evidence | WBPaper00035407 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000379 | Paper_evidence | WBPaper00000031 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | Notched head. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | variable penetrance | Paper_evidence | WBPaper00000031 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00040551 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "As a consequence of the protrusion defects or gaps between nonsister cells, the presumptive pocket bridge cells are impeded in their migration over the scaffold cells to reach the midline. The entire group of unrearranged cells caused by this defect is referred to hereafter as the "obstructed bridge" even though in many embryos it appears to assemble with a delay just in advance of P9/10 cell migration (see below). An obstructed pocket bridge variably hindered progression of P9/10 cells toward the midline (Figures 2C and 2E). In some vab-1 mutant embryos, P9/10 cells progressed minimally toward the ventral midline. In these cases, blocks in P9/10 migration often occurred at borders between scaffold cells (Figure 2E). In other embryos there was substantial progression of P9/10 cells toward the midline, but this was slower than in wild-type embryos and involved movement of the entire leading edge of the presumptive bridge cells toward the midline just in advance of the P9/10 leading edge (see Discussion). Five of eight P9/10 cells in kinase dead embryos and only eight of 28 in null embryos reached the midline before embryo elongation began. There were also few, if any, kinase dead embryos in which a P9/10 cell failed to migrate at all or migrated minimally toward the midline (0 of 8 compared to 12 of 28 for null embryos). Among the types of mutant embryos observed, only those in which both P9/10 cells fail to migrate (5 of 14 null and 0 of 4 kinase dead) have a severe open pocket defect at the time embryo elongation begins, whereas others have a small open pocket defect (Figure 2E). These results suggest that the ability of P9/10 cells to migrate over an obstructed pocket bridge is efficient enough in vab-1 null embryos to account for their 60% embryonic viability but even more efficient in vab-1 kinase dead embryos accounting for their 94% viability." | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004412 | PATO:0000460 | Paper_evidence | WBPaper00040551 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004411 | PATO:0000460 | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00040551 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001346 | Paper_evidence | WBPaper00040551 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To further examine the roles of Eph receptor and semaphorin signaling in pocket closure, we followed dozens of carefully staged embryos of vab-1 null and kinase dead mutants and also analyzed null (n = 14) and kinase dead (n = 4) embryos by time-lapse photomicroscopy. The spatiotemporal pattern of plx-2 expression revealed that the pocket bridge and scaffold progenitors, their subsequent divisions, and adhesion between sister cells appeared unaffected in all vab-1 null and kinase dead embryos examined (Figures 1C and 2C; Figure S2). Reported gastrulation defects in vab-1(0) embryos [8] did not produce obvious disorganization of plexin band cells in any embryos we examined, possibly because embryos can correct or bypass these defects. However, we did find that none of the vab-1(0) or vab-1(k) mutant embryos was able to form or maintain the narrow bridge cell protrusions that normally extend over the anterior surface of the scaffold cells to pull the presumptive bridge cells to the midline. These protrusions were also never observed in the staged mutant embryos." | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00040551 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001530 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Variable dystrophy of ventral cephalic region, especially in L1; penetrance < 70%. Easy to impossible to score (ES3/0). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | <70% | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002045 | Paper_evidence | WBPaper00040629 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants show decreased germ-cell corpse numbers. | Paper_evidence | WBPaper00040629 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002403 | Paper_evidence | WBPaper00040551 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "George et al. [8] previously found that P cell midline alignment and embryonic lethal defects are relatively rare in the kinase dead [vab-1(e2)] mutant embryos compared to vab-1(0) embryos (see also Figures 5A and 5C; Table S2), suggesting that a kinase-independent function of VAB-1 is largely sufficient for these processes." | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 3 | Paper_evidence | WBPaper00040551 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008115 | PATO:0001654 | Paper_evidence | WBPaper00040551 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00040551 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002404 | Paper_evidence | WBPaper00040551 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Although the absence of these protrusions is the likely cause of ventral pocket defects in vab-1 null embryos, 97% of these also have gaps between nonsister plexin band cells beyond 340' post-first cleavage (PFC) of the zygote (Figure 1C, 340'; Figure 2C; Figure S2) when these gaps are usually closed in wild-type embryos (Figure 1B, 340'; Figure 2B). These gaps could, in principle, also be causal for embryonic lethality, however, in most null and kinase dead embryos, these gaps are closed with a delay (i.e, after 340' PFC), possibly by small filopodia-like protrusions sometimes seen emanating from bridge and scaffold cells (Figure S2, 360' closed arrowhead) or by constriction of the entire midline region. This suggests that these gaps delay rather than block pocket closure." | Paper_evidence | WBPaper00040551 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00040551 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |